Light cycler thermal cycler system

Total RNA was isolated using Trizol reagent (Invitrogen, United States). RNA samples from each group were reverse transcribed into cDNA using PrimeScriptTM RT reagent Kit (TAKARA, Japan). Quantitative RT-qPCR was performed on a Light Cycler thermal cycler system (Bio-Rad, United States) using SYBR^®Premix Ex Taq^TMII (TAKARA, Japan) and gene-specific primers. Gene-specific primers used as followed: SIRT1: forward, 5′- CATACTCGCCACCTAACCTAT -3′ and revised, 5′- AACCTCTGCCTCATCTACATTT -3′, at a fragment length of 93 bp; VEGFA: forward, 5′- CCTCTCCCTACCCCACTTCCT -3′ and revised, 5′- CACTTTCTCTTTTCTCTGCCTCCAT -3′, at a fragment length of 196 bp; β-actin: forward, 5′- CCGTAAAGACCTCTATGCCAACA -3′ and revised, 5′- CTAGGAGCCAGGGCAGTAATCTC -3′, at a fragment length of 102 bp.

Total RNA of BMSCs transfected with lentiviral was isolated using Trizol reagent (Invitrogen, United States). RNA samples from each group were reverse transcribed into cDNA using the PrimeScript™ RT reagent Kit (TAKARA, Japan). qPCR was performed on a Light Cycler thermal cycler system (Bio-Rad, United States) using SYBR Premix Ex Taq™II (TAKARA, Japan) and gene-specific primers. Gene-specific primers used are as follows: CXCR4—forward 5′-CGCAAATGGGCGGTAGGCGTG-3′ and reverse 5′-CATAGCGTAAAAGGAGCAACA-3′, and GAPDH—forward 5′-CCGCATCT TCTTGTGCAGTG-3′ and reverse 5′-ACCAGC TTCCCATTCTCAGC-3′.

Total RNA was extracted using Trizol reagent (Invitrogen, United States). Then, the RNA of each group was reverse transcribed into cDNA with PrimeScriptTM RT reagent Kit (TAKARA, RR047A, Japan). Quantitative RT-qPCR was performed by a Light Cycler thermal cycler system (Bio-Rad, United States) using iQ SYBR Green Supermix (Bio-Rad, United States). The designed gene-specific primers were as follows: Sirt1: forward, 5′-GAG​TGT​GCT​GGA​GGA​TCT​G -3′, and reverse, 5′- TGC​TCT​GAT​TTG​TCT​GGT​GT-3′; total Mapt: forward, 5′-CCA​GGA​GTT​TGA​CAC​AAT​GGA​AGA​C-3′, and reverse, 5′-CTG​CTT​CTT​CAG​CTT​TTA​AGC​CAT​G-3′; GAPDH: forward, 5′-ATG​GCT​ACA​GCA​ACA​GGG​T-3′, and reverse, 5′-TTA​TGG​GGT​CTG​GGA​TGG-3′.

Total RNA was isolated from affected hippocampal tissues using Trizol reagent (Invitrogen) before being reverse transcribed into cDNA using Prime Script TM RT reagent Kit (TAKARA). Then RT-qPCR was performed using SYBR R Premix Ex TaqTMII (TAKARA) and gene-specific primers on a Light Cycler thermal cycler system (Bio-Rad). The gene-specific primers were as follows: reelin: forward, 5′-TGGGATAACATGGAAACTCTTGGAG-3′ and revised, 5′-ACCATCTGAACTGGATTCCAAACTG-3; tau: forward, 5′-CCAGGAGTTTGACACAATGGAAGAC-3′ and revised, 5′-CTGCTTCTTCAGCTTTTAAGCCATG-3′; GAPDH: forward, 5′-ATCGCCAGTCCGTCTTCTACATC-3′ and revised, 5’-TGATCGTGGTGACTCCCATCC-3′.

Total RNA was extracted by Trizol reagent (Invitrogen, United States). The RNA was then transcripted reversely into complementary deoxyribonucleic acid (cDNA) using a PrimeScript^TM RT reagent Kit (TAKARA, Japan), used as the template for polymerase chain reaction amplification. Quantitative RT-qPCR was conducted on a Light Cycler thermal cycler system (Bio-Rad, United States) using SYBR^® Premix Ex Taq^TM II (TAKARA, Japan). Gene-specific primers were used as follows: Cx43: The upstream primer: 5′−GGAAAGTACCAAACAGCAGCAG−3′, the downstream primer: 5′−CTGGGCACCTCTCTTTCACTT−3′, the amplified fragment was 152 bp; AQP4: The upstream primer: 5′−CATGGAGGTGGAGGACAACC−3′, the downstream primer: 5′−GCAGGAAATCTGAGGCCAGT−3′, the amplified fragment was 200 bp; GAPDH: The upstream primer: 5′−TGAAGAACAGGGAAGCAGCAA−3′, the downstream primer: 5′−ATCCAGTCCATTTTCCACCACA−3′, the amplified fragment was 200 bp. Amplification system: SYBR^® Premix Ex Taq^TM II 12.5 μl, Forward Primer (10 μm) 1 μl, Reverse Primer (10 μm) 1 μl, cDNA Template 2 μl, RNase FreedH₂O 8.5 μl, and the final volume was 25 μl; amplification conditions: step 1: 95°C for 30 s, 1 cycle; step 2: 95°C for 5 s and 60°C for 30 s, 40 cycles; step 3: 95°C for 15 s, 60°C for 15 s, and 95°C for 15 s.