Total RNA from white adipose tissue was extracted using a commercial kit from Invitrogen. RNAs from other tissues and cultured cells was extracted using TRIzol method. For quantitative real-time PCR (qPCR) analysis, equal amount of RNA was reverse-transcribed using MMLV-RT followed by quantitative PCR reactions using SYBR Green (Life Technologies). Relative abundance of mRNA was normalized to ribosomal protein 36B4. For detecting the coding isoform of Nrg4 using Taqman PCR, we designed sense primer encompassing the junction of exon3 and exon6 (5′ CCCAGCCCATTCTGTAGGTG3′), anti-sense primer in exon6 (5′ACCACGAAAGCTG-CCGACAG 3′), and a taqman probe in exon6 but between sense and anti-sense primers (5′ 6-FAM-CGGAGCACGCTGCGAAGAGGTT-BHQ 3′). Taqman PCR was carried out using the Taqman Universal PCR Master Mix system (Applied Biosystems). Relative abundance of the Nrg4 coding isoform was normalized to ribosomal protein 36B4.
For microarray study of liver gene expression, total liver RNA isolated from HFD-fed WT and Nrg4 KO mice was used to generate probes for Affymetrix Mouse MG-430 PM array strips. Sample processing and data analyses were performed according to the manufacturer’s instruction. The dataset has been deposited into the NCBI Gene Expression Omnibus (GEO) database with accession number GSE53877.
For microarray study of liver gene expression, total liver RNA isolated from HFD-fed WT and Nrg4 KO mice was used to generate probes for Affymetrix Mouse MG-430 PM array strips. Sample processing and data analyses were performed according to the manufacturer’s instruction. The dataset has been deposited into the NCBI Gene Expression Omnibus (GEO) database with accession number GSE53877.