Total RNA was extracted from engineered tissues resulting from the 5 weeks in vitro culture using the Quick-RNA™ extraction kit (Zymo Research, Irvine, CA, USA, R1055), according to manufacturer’s instructions. Following cDNA synthesis (Invitrogen 18080044 & Promega, C1181), qRT-PCR was performed using assay on demand (Applied Biosystems, Foster City, CA, USA) on the following genes: Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Hs02758991_g1), Indian Hedge Hog (IHH, Hs01081800_m1), SRY-box 9 (SOX9, Hs00165814_m1), Matrix metalloproteinase 13 (MMP13, Hs00233992_m1), Collagen type II (ColII, Hs00264051_m1), Collagen type X (ColX, Hs00166657_m1), Vascular endothelial growth factor (VEGF, Hs00900055_m1), Bone morphogenetic protein 2 (BMP2, Hs00154192), Osteocalcin (OCN, Hs01587814_g1), and Bone sialoprotein (BSP, Hs00959010_m1).
Quick rna extraction kit
Manufactured by Zymo Research
Sourced in United States
The Quick RNA extraction kit is a laboratory product designed for the rapid and efficient extraction of RNA from a variety of sample types. It utilizes a simple and streamlined protocol to purify high-quality RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000 system, by Thermo Fisher Scientific (2 mentions)
C1181, by Promega (1 mentions)
Abi prism 7900ht sequence detection system, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Genechip operating software, by Thermo Fisher Scientific (1 mentions)
Genechip mogene 2.0 st array, by Thermo Fisher Scientific (1 mentions)
Genespring gx11, by Agilent Technologies (1 mentions)
Abi quantstudio 6 flex system, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix kit, by Takara Bio (1 mentions)
Tb green premix ex taq 2 kit, by Takara Bio (1 mentions)
M mlv reverse transcriptase, by Promega (1 mentions)
Dnase 1, by New England Biolabs (1 mentions)
Ultrahyb oligo buffer, by Thermo Fisher Scientific (1 mentions)
Dnase 1, by Zymo Research (1 mentions)
8 protocols using quick rna extraction kit
1
Molecular Profiling of Engineered Tissues
2
Transcriptional Expression Profiling of Immune Regulators
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from the brain, spleen, and PBMC were extracted using Quick RNA extraction Kit (Zymo research, CA, USA). Strand cDNA was synthesized from 100 ng of total RNA using High-Capacity cDNA Reverse Transcription Kit (4368814, Applied Biosystems, MA, USA) as per the manufacturer's instructions. qRT-PCR was performed by the Icahn School of Medicine qPCR Core and analyzed by ABI PRISM 7900HT Sequence Detection System (Applied Biosystems). Utilized cycling conditions were as follows: 95°C for 2 min, followed by 40 cycles of 95°C for 15 s, 60°C for 15 s, and 72°C for 1 min. The primer sequences were as follows: Foxp3-F, 5′-AGAGCTCTTGTCCATTGAGGCCA-3′, Foxp3-R, 5′-TGTCCTGGGCTACCCTACTG-3′; Cxcl10-F, 5′-ATGACGGGCCAGTGAGAATG-3′, Cxcl10-R, 5′-GAGGCTCTCTGCTGTCCATC-3′; Caspase-1-F, 5′-CACATTTCCAGGACTGACTGG-3′, Caspase-1-R, 5′-AGACGTGTACGAGTGGTTGT-3′; Nlrp3-F, 5′-AGAAGAGACCACGGCAGAA-3′, Nlrp3-R, 5′-CCTTGGACCAGGTTCAGTGT-3′; IL-1β-F, 5′-TTCAGGCAGGCAGTATCACTC-3′; IL-1β-R, 5′-CCACGGGAAAGACACAGGTAG-3′; and Hprt-F, 5′-CCCCAAAATGGTTAAGGTTGC-3′, Hprt-R-5′-AACAAAGTCTGGCCTGTATCC-3. Expression level of Hprt was used as an internal control, and relative mRNA expression of other genes were quantified using the 2−ΔΔCq method.
3
Transcriptomic Analysis of Tifab Knockout Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression analysis (MoGene 2.0 ST Array) was performed on sorted LSK isolated from 3-mo-old mice transplanted with Tifab+/+ or Tifab−/− BM cells (n = 3 mice/group). Total RNA was extracted and purified with Quick RNA extraction kit (Zymo Research). Total RNA was reverse transcribed, labeled, and hybridized onto the GeneChip MoGene 2.0 ST Array (Affymetrix). Scanning was performed with GeneChip Version 3.2 Scanner 3000 7G (Affymetrix) and evaluated with GeneChip operating software (Affymetrix). Data analysis was performed using GeneSpring GX 11.5 software (Agilent Technologies). Gene set enrichment analysis was performed on a JAVA-based dataset supported by the Broad Institute (Subramanian et al., 2005 (link)).
4
Quantitative Gene Expression Analysis of NHEKs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NHEKs treated as described above were lysed and total RNA was isolated with a quick RNA extraction kit (Zymo Research, #TR205, Beijing, China) according to the manufacturer’s instructions. mRNA was reverse-transcribed into cDNA using the PrimeScript RT Master Mix Kit (Takara, Shiga, Japan). Next, qRT-PCR was conducted in ABI Quantstudio 6 Flex system (ThermoFisher, CA, USA) using the TB Green Premix Ex Taq II Kit (Takara, Shiga, Japan) as following settings: initial denaturation at 95°C for 30s, followed by 40 cycles of 95°C for 5 s, 60°C for 34s. GAPDH was used as the endogenous control. All primers were purchased from BioTNT (Shanghai, China) and their sequence were as follows: GAPDH, 5’-GGG AAG GTG AAG GTC GGA GT-3’ (forward) and 5’-GGG GTC ATT GAT GGC AAC A-3’ (reverse); IL-6, 5’-AAC AAC CTG AAC CTT CCA AAG-3’ (forward) and 5’-CAA ACT CCA AAA GAC CAG TGA-3’ (reverse); IL-8, 5’-CTG TTA AAT CTG GCA ACC CTA-3’ (forward) and 5’-GTG AGG TAA GAT GGT GGC TAA-3’ (reverse); TNF-α, 5’-CAG GAC TTG AGA AGA CCT CAC-3’ (forward) and 5’-GTC TGG AAA CAT CTG GAG AGA-3’ (reverse).
5
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted RNA from the NPCs and brain organoids at 2, 4, 8, and 10 weeks of differentiation using the Quick RNA extraction kit (Zymo). We quantified the integrity of RNA with NanoDrop. We reverse-transcribed cDNA using M-MLV Reverse Transcriptase (Promega) and random hexamer primers as described previously (44 (link)). We used the TaqMan gene expression assay to perform real-time polymerase chain reaction (RT-PCR).
6
Quantifying tRNA Charging for Serine and Methionine
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine tRNA charging of serine and methionine tRNAs, a tRNA deacylation and β-elimination treatment was performed as previously described (25 (link)). Briefly, total RNA was extracted from no treatment and SHX-treated flash frozen cells using the Quick RNA extraction kit (Zymo) following the standard protocol. The RNA was then DNase I (NEB) treated for two hrs using 2 units of DNase I per hour and was cleaned of residual DNase I with the RNA clean and concentrator-5 (Zymo). DNase-treated RNA was then divided into two equal aliquots; one of the aliquots was deacylated by treatment with 1 M Tris pH 9 at 37°C for 1 h, and then ethanol precipitated. Following deacylation, both aliquots were treated with sodium periodate and 1 M lysine to promote β-elimination of oxidized 3′ RNA ends, and then ethanol precipitated. Samples were then run on a 10% TBE 7 M urea denaturing polyacrylamide gel. RNA was transferred using a wet transfer apparatus (Hoefer TE62) onto a nylon membrane and UV crosslinked to the membrane using the automatic setting (UV Stratalinker 1800). Membranes were probed in Ultrahyb Oligo buffer (Ambion) with 5′-32P-labeled (tRNASer) TCACGTGTCCGAATGGACAGTAGA or 5′-32P-labeled (tRNAMet) ATGAGCCCGGCGGAATCTCCT and signal was detected on a Typhoon phosphoimager.
7
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were viral transduced with sgRNA targeting the gene of interest or control sgRNA for 3 days and selected with puromycin for pure population for 3 days. The entire setup of the experiment was done in three biological replicates. Post-selection RNA was extracted from the cells as per the manufacturer’s protocol using the Zymo Quick-RNA-extraction kit Cat# R1054. RNA quantification was done using Thermo Scientific Nanodrop 2000 system. cDNA was prepared using SuperScript III First-Strand Synthesis System for RT-PCR (Cat # 18080-051). QuantStudio Flex Real-Time PCR system was used to measure mRNA expression of gene of interest. The list of all primers used is provided in Supplementary Table 1 .
8
BRSV Detection in Wastewater Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To minimize variability between the technical replicates of each concentration and extraction protocol, duplicate samples were concentrated and pooled. Duplicate RNA was extracted from each pooled concentrated sample and again RNA samples were pooled. Wastewater samples were also concentrated to determine background BRSV level, but BRSV could not be detected in any of the wastewater samples. Furthermore, method negative controls (i.e., nuclease-free water) were included for each concentration protocol. Additionally, triplicate method positive controls (i.e., BRSV seeded into nuclease-free water) were concentrated using protocol 7 and extracted with Zymo Quick RNA extraction kit to reveal BRSV recovery from water samples. To account for any contamination during RNA extraction, extraction negative controls were included. No template controls (NTCs) were included in each qPCR. No amplification was observed in any of the negative controls. RT-qPCR assays were performed in triplicate for each sample. Results are reported as the average of triplicate analysis with standard deviations for each sample.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!