Qrt pcr

The collected cells and the fully ground brain tissue were added to a solution of Trizol (Invitrogen, 15596026), and the total RNA in the tissues and cells were separated and extracted according to the Trizol reagent operating instructions. After the first strand cDNA (Thermo, K1622) was synthesized by reverse transcription, detect the reaction of OPG, RANKL, RANK according to the qRT-PCR (Qiagen, 204057) method kit instructions. The primer sequence is shown in Table 1, synthesized by Shanghai Shenggong Biotech Co., Ltd. The reaction conditions were pre-denaturation: 95°C for 30 s; PCR reaction: 95°C for 5 s, 60°C for 20 s, 40 cycles; melting curve analysis: 95°C for 1 s, 65°C for 15 s, 95°C for 5 s. After the reaction was completed, the amplification curve and the melting curve were confirmed.

Total RNA was extracted from single-cell suspensions using easy-BLUE (iNtRON). RNA was reverse-transcribed and cDNA was amplified using specific primers for GAPDH (5′-CCACTGGCGTCTTCACCAC-3′ and 5′-CCTGCTTCACCACCTTCTTG-3′), CD25 (5′-TTCGTGATGTTGGGGTTTCTC-3′ and 5′-TGTCTGTTGTGGTTTGTTGCTCT-3′), CD122 (5′-GTGGACCTCCTTGACATA-3′ and 5′-GTTTCGTTGAGCTTTGACCCTCA-3′), CD132 (5′-CTGGGGGAGTCATACTGTAGAGG-3′ and 5′-AGGCTTCCGGCTTCAGAGAAT-3′), iNOS (5′-GAGATTGGAGTTCGAGACTTC-3′ and 5′-TGGCTAGTGCTTCAGACTTC-3′), and IFN-γRα (5′-GGTGCCTGTACCGACGAATG-3′ and 5′-AACATGGTTCCCTGGCTCTC-3′). The IL-2, CD25, CD122, CD132, 4E-BP1, and 18S primers for quantitative RT-PCR (qRT-PCR) were purchased from QIAGEN (Hilden, Germany).

Frozen brain tissue lysis was prepared by Trizol (Invitrogen, 15596026, USA). Total RNA of tissues and cells were extracted according to the Trizol reagent operating instructions. After the first-strand cDNA (Thermo, K1622, USA) was synthesized by reverse transcription, TLR2, TLR4, MyD88, and NF-κB reactions were detected by qRT-PCR (Qiagen, 204057, Germany). The primer sequences are shown in Table 2, which were synthesized by Shanghai Shenggong Biological Co., Ltd. The reaction conditions were predenaturation: 95°C for 30 s; PCR reaction: 95°C for 5 s and 60°C for 20 s, 40 cycles; and melting curve analysis: 95°C for 1 s, 65°C for 15 s, and 95°C for 5 s. After the reaction was completed, the amplification curve and the melting curve were confirmed.

The expression of chemokine, cytokine, and neurotrophin genes, as well as those associated with phagocytosis, was determined first with RT² Profiler PCR arrays (Qiagen) on a Bio-Rad myIQ2 Real-Time PCR instrument. The manufacturer’s software was used to analyze the data. Alterations in individual genes were confirmed using individual PCR primer sets for qRT-PCR (Qiagen; Table 1). Individual reactions contained 5.5 μl nuclease-free water, 2 μl primer mix (both forward and reverse) at 10 μM, and 12.5 μl Bio-Rad Sybr Green Supermix ±5 μl template DNA or no template control (nuclease-free water). Forty cycles of PCTR were performed following an initial 10 min denaturation at 95°C. For each cycle, a 1 min annealing step at 60°C preceded a 15-s melting interval at 95°C. Melting curves were obtained using a stepped temperature gradient of 0.5°C × 10 s starting at 60°C. Transcript expression levels were then compared to standard housekeeping genes (β-actin and GAPDH) and to those of untreated cells using the 2^-ΔΔCT method, where C_T (threshold cycle). This method was used on each individual example with the untreated sample as the comparator (Schmittgen and Livak, 2008 (link)). Triplicate samples were analyzed from a minimum of three independent biological replicates for each time point.

For the cultivation of the nasopharyngeal swabs, S. aureus was plated on Columbia agar plates (5% sheep blood) and incubated at 37 °C for 24 h. The identification and resistance determination were carried out by using matrix-assisted laser desorption/ionization (MALDI), and time-of-flight (TOF) analyzer (MALDI-TOF) and VITEK MS (bioMérieux, Marcy l ‘Ètoile). For each group, 20 S. aureus isolates of colonization, CAP, and HAP-strains and 10 co-infection strains were randomly selected and subjected to genotyping. By using genotyping, we can exclude clonal identity of the examined strains. For phenotypic analysis, we selected 10 strains from each group. All S. aureus strains from co-infection were isolated from IAV-infected patients, detected with qRT-PCR (QIAGEN, Hilden, Germany).

RNA was extracted from granulosa cells and converted into cDNA according to the Smart-seq2 protocol (17 (link)). cDNA was amplified and purified twice by using AMPure XP beads and 80% ethyl alcohol after the first strand reaction. The significantly differentially expressed genes were validated by qRT-PCR (208054, QIAGEN, Germany). Following were the sequences of the two primers: EGFR primers (sense primer, AGGCACGAGTAACAAGCTCAC; antisense primer, ATGAGGACATAACCAGCCACC) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primers (sense primer, ACCCGCCCTATCTCAACTACC, antisense primer, AGGACACCATAATGACAGCC). qRT-PCR was performed in a total reaction volume of 25 μL, including 1 μL cDNA (1 ng/μL), 10 μL 2x SYBR green PCR master mix, 0.1 μL QN ROX reference dye, 1 μL forward primer (10 mmol/L), 1 μL reverse primer (10 mmol/L), and 6.9 μL RNase-free water. The PCR initial activation was achieved by heating the samples to 95°C for 2 min, followed by a total of 40 cycles of denaturation at 95°C (5 s) and 60°C (30 s).