Deuterated dimethyl sulfoxide

Manufactured by Cambridge Isotopes

Deuterated dimethyl sulfoxide is a deuterium-labeled variant of the organic solvent dimethyl sulfoxide. It is commonly used as a solvent and reagent in various chemical and biological applications.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Deuterated dimethyl sulfoxide (DMSO-d6) (12 citations)

9 protocols using deuterated dimethyl sulfoxide

Copper-Catalyzed Azide-Alkyne Cycloaddition

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals were used as provided without further purification unless noted otherwise. Tetrahydrofuran, triethylamine, oxalyl chloride, propargyl amine, sodium ascorbate, neocuproine, hexa (ethylene glycol) dithiol, glycerol ethoxylate, PEG 600 diol and hexafluorobenzene were purchased from Sigma Aldrich. Deuterobenzene, deuterated dimethyl sulfoxide and deuterochloroform were purchased from Cambridge Isotope Laboratories (CIL). Copper(II) acetate was obtained from Acros Organics and 2,2-Dimethoxy-2-phenylacetophenone (DMPA) from TCI. TBTA was synthesized following a previously published procedure.⁴³ Perfluorotripropylamine (FC 3283), methoxyperfluorobutane (HFE 7100), 2-(Trifluoromethyl)-3-ethoxydodecafluorohexane (HFE 7500) and Krytox FSH were obtained from Miller-Stephenson. Acetonitrile was obtained from EMD and hexafluoroisopropanol (HFIP) from Alfa-Aesar. Thiourea was purchased from Chem-Impex International and ethanol, methanol, sodium hydroxide and hydrochloric acid were obtained from Macron Fine Chemicals.

Scanga R., Chrastecka L., Mohammad R., Meadows A., Quan P.L, & Brouzes E. (2018). Click chemistry approaches to expand the repertoire of PEG-based fluorinated surfactants for droplet microfluidics. RSC Advances, 8(23), 12960-12974.

+ Open protocol

+ Expand

Fluorinated Clickable Polymer Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals were used as provided without further purification unless noted otherwise. Tetrahydrofuran, triethylamine, oxalyl chloride, propargyl amine, sodium ascorbate, neocuproine, hexa (ethylene glycol) dithiol, glycerol ethoxylate, PEG 600 diol and hexafluorobenzene were purchased from Sigma Aldrich. Deuterobenzene, deuterated dimethyl sulfoxide and deuterochloroform were purchased from Cambridge Isotope Laboratories (CIL). Copper(ii) acetate was obtained from Acros Organics and 2,2-dimethoxy-2-phenylacetophenone (DMPA) from TCI. TBTA was synthesized following a previously published procedure.⁴³ Perfluorotripropylamine (FC 3283), methoxyperfluorobutane (HFE 7100), 2-(trifluoromethyl)-3-ethoxydodecafluorohexane (HFE 7500) and Krytox FSH were obtained from Miller-Stephenson. Acetonitrile (MeCN) was obtained from EMD and hexafluoroisopropanol (HFIP) from Alfa-Aesar. Thiourea was purchased from Chem-Impex International and ethanol, methanol, sodium hydroxide and hydrochloric acid were obtained from Macron Fine Chemicals.

+ Open protocol

+ Expand

Synthesis and Characterization of CPTEG:CPH Copolymer Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the synthesis of the 1,6-bis(p-carboxyphenoxy)hexane (CPH) and 1,8-bis(p-carboxyphenoxy)-3,6-dioxaoctane (CPTEG) monomers and the corresponding 20:80 CPTEG:CPH copolymer, and the ivermectin and doxycycline-loaded nanoparticles, acetic acid, acetic anhydride, acetone, acetonitrile, chloroform, dimethyl formamide, ethyl ether, hexane, methylene chloride, pentane, petroleum ether, potassium carbonate, sodium hydroxide, sulfuric acid, and toluene were purchased from Fisher Scientific (Fairlawn, NJ). The chemicals 1,6-dibromohexane, 1-methyl-2-pyrrolidinone, hydroxybenzoic acid, N,N-dimethylacetamide, sebacic acid, and tri-ethylene glycol were obtained from Sigma Aldrich (St. Louis, MO). The chemical 4-p-fluorobenzonitrile was purchased from Apollo Scientific (Cheshire, UK). For ¹H NMR analysis deuterated chloroform and deuterated dimethyl sulfoxide were purchased from Cambridge Isotope Laboratories (Andover, MA). Rhodamine B, a fluorescent dye, and the drugs, ivermectin and doxycycline, were purchased from Sigma Life Science (St. Louis, MO).

Binnebose A.M., Haughney S.L., Martin R., Imerman P.M., Narasimhan B, & Bellaire B.H. (2015). Polyanhydride Nanoparticle Delivery Platform Dramatically Enhances Killing of Filarial Worms. PLoS Neglected Tropical Diseases, 9(10), e0004173.

+ Open protocol

+ Expand

Characterization of Ureidopyrimidinone-Modified Gelatin

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ureidopyrimidinone, gelatin and ureidopyrimidinone substituted gelatin derivatives were characterized by ¹H NMR spectroscopy for chemical analysis using AVANCE I 400 MHz spectrometer. For ¹H NMR spectral analysis of ureidopyrimidinone, sample was prepared by mixing 10 mg of ureidopyrimidinone powder in 700 μl deuterated chloroform. Gelatin and ureidopyrimidinone modified gelatin derivative samples were prepared by mixing 10 mg of powder sample in deuterated dimethyl sulfoxide (Cambridge Isotope laboratories, Inc). Further samples were loaded in NMR tubes to obtain ¹H NMR spectrum. Samples were scanned from 0 ppm to 10 ppm at 400 MHz frequency.

Panwar A., Sk M.M., Lee B.H, & Tan L.P. (2022). Synthesis and fabrication of gelatin-based elastomeric hydrogels through cosolvent-induced polymer restructuring. RSC Advances, 12(13), 7922-7934.

+ Open protocol

+ Expand

Oxidation and Cyclization of Levoglucosenone

Check if the same lab product or an alternative is used in the 5 most similar protocols

Levoglucosenone was graciously provided by the Circa Group. Potassium carbonate 99% (Acros), hydrogen peroxide 30% (Fischer), diethyl succinate 98% (Alpha Aesar), malonyl chloride 97% (Sigma Aldrich), succinyl chloride 95% (Sigma Aldrich), adipoyl chloride 98% (Sigma Aldrich), glutaryl chloride 97% (Sigma Aldrich), terephthaloyl chloride >99% flakes (Sigma Aldrich) were used without further purification unless mentioned. NMR solvents including deuterated chloroform, deuterated methanol, and deuterated dimethyl sulfoxide were purchased from Cambridge Isotopes Laboratories.

Diot-Néant F., Mouterde L., Fadlallah S., Miller S.A, & Allais F. (2020). Sustainable Synthesis and Polycondensation of Levoglucosenone-Cyrene-Based Bicyclic Diol Monomer: Access to Renewable Polyesters. ChemSusChem, 13(10).

+ Open protocol

+ Expand

Characterization of Synthetic Oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols

Acetonitrile (99.7% purity) was purchased from Alfa Aesar. Deuterated chloroform (CDCl₃), deuterated dimethyl sulfoxide ((CD₃)₂SO), and deuterium oxide (D2O) were purchased at 99.9% purity from Cambridge Isotope Laboratories. Methanol (99.8% purity) was purchased from Acros Organics. Linear Polyethylenimine (2500 Da) was purchased from Polysciences, Inc. Pentaethylenehexamine (PEHA) and tetraethylenepentamine (TEPA) were purchased at 85−90% purity, while diethylenetriamine (DETA) was purchased at 99% purity from Sigma Aldrich. N-ethylpropylamine (NEPA) was purchased at 97% purity from Alfa Aesar. Oligonucleotides with the sequence GCACACATCGGACAGTTTGA were purchased from Synbio Technologies. All aqueous samples were prepared in MilliQ (18.2 MΩ) water.

Mustafa R., Fitian M., Hamilton N.B., Li J., Silva W.R, & Punihaole D. (2022). Molecular Insights Into the Binding of Linear Polyethyleneimines and single-stranded DNA using Raman Spectroscopy: A Quantitative Approach. The journal of physical chemistry. B, 126(42), 8404-8414.

+ Open protocol

+ Expand

Synthesis of Alkyl Halides and Ionic Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols

N,N,N′,N′-Tetramethylethylenediamine, n-ethyl bromide, n-butyl bromide, n-hexyl bromide, n-octyl bromide, and n-decyl bromide were purchased from Tokyo Chemical Industry
Co., Ltd. (Tokyo, Japan). Trimethylamine hydrochloride, silver tetrafluoroborate
(AgBF₄), potassium hexafluorophosphate (KPF₆), potassium trifluoromethanesulfonate (KOTf), acetone, acetonitrile,
chloroform, dichloromethane, dimethyl sulfoxide (DMSO), ethanol, ethyl
acetate, hexane, methanol, and sodium hydroxide were purchased from
FUJIFILM Wako Pure Chemical Co., Ltd. (Osaka, Japan). Potassium bis(trifluoromethanesulfonyl)amide
(KNTf₂) and thymolphthalein were purchased from Kanto Chemicals
Co., Inc. (Tokyo, Japan), and potassium bis(fluorosulfonyl)amide (KFSA)
was supplied by Nippon Shokubai Co., Ltd. (Osaka, Japan). The deuterated
chloroform, deuterium oxide, and deuterated dimethyl sulfoxide used
in the ¹H NMR measurements were purchased from Cambridge
Isotope Laboratories Inc. (Andover). All chemicals were used without
further purification. Water from a Merck KGaA Direct-Q UV system (resistivity
= 18.2 MΩ cm, Darmstadt, Germany) was used in all of the experiments.

Kawai R., Yada S, & Yoshimura T. (2019). Characterization and Solution Properties of Quaternary-Ammonium-Salt-Type Amphiphilic Gemini Ionic Liquids. ACS Omega, 4(10), 14242-14250.

+ Open protocol

+ Expand

Synthesis and Characterization of Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chemicals needed for monomer synthesis, polymerization, and nanoparticle synthesis included anhydrous (99+%) 1-methyl-2-pyrrolidinone (Aldrich, Milwaukee, WI); 1,6-dibromohexane, 4-p-hydroxybenzoic acid, N,N-dimethylacetamide, triethylene glycol and Span^® 80 (Sigma Aldrich, St. Louis, MO); 4-p-fluorobenzonitrile (Apollo Scientific, Cheshire, UK); acetic acid, acetic anhydride, acetone, acetonitrile, dimethyl formamide (DMF), hexanes, methylene chloride, pentane, potassium carbonate, sodium hydroxide, sulfuric acid, and toluene (Fisher Scientific, Fairlawn, NJ). For NMR characterization, deuterated dimethyl sulfoxide was purchased from Cambridge Isotope Laboratories (Andover, MA).

Vela Ramirez J.E., Tygrett L.T., Hao J., Habte H.H., Cho M.W., Greenspan N.S., Waldschmidt T.J, & Narasimhan B. (2016). Polyanhydride Nanovaccines Induce Germinal Center B Cell Formation and Sustained Serum Antibody Responses. Journal of biomedical nanotechnology, 12(6), 1303-1311.

+ Open protocol

+ Expand

Multifunctional Polymer Nanocomposite Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

All reagents were used as received. Sebacic acid, hydroxybenzoic acid, dibromohexane, 1-methyl-2-pyrrolidinone, meth-acrylic acid (MAA), 1-hydroxycyclohexyl phenyl ketone (Irgacure 184), Span 80, CdSeS/ZnS alloyed quantum dots (λ_em = 525 nm), and albumin from chicken egg white were purchased from Sigma-Aldrich (St. Louis, MO). Sodium hydroxide, acetone, sulfuric acid, acetic anhydride, methylene chloride, hexanes, and pentane were obtained from Fisher Scientific (Hanover Park, IL). Polyethylene glycol monomethyl ether methacrylate (PEGMMA, MW 1000) was purchased from Polysciences Inc. (Warrington, PA), and TAMRA-cadaverine was obtained from Biotium (Fremont, CA). (1-Ethyl-3-(3-(dimethylamino)propyl)carbodiimide hydrochloride) (EDC) and N-hydroxysuccinimide (NHS) were obtained from Thermo Fisher Scientific (Waltham, MA). Deuterated dimethyl sulfoxide and deuterated chloroform were purchased from Cambridge Isotope Laboratories (Andover, MA). All other solvents and buffers were also obtained from Thermo Fisher Scientific. Reagents used for cell culture were Dulbecco’s Modified Eagle Medium (DMEM), penicillin — streptomycin, and fetal bovine serum from Thermo Fisher Scientific, and L-glutamine from Sigma-Aldrich.

Sharpe L.A., Vela Ramirez J.E., Haddadin O.M., Ross K.A., Narasimhan B, & Peppas N.A. (2018). pH-Responsive Microencapsulation Systems for the Oral Delivery of Polyanhydride Nanoparticles. Biomacromolecules, 19(3), 793-802.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!