Petduet 1 vector

The construct used for R-Eno_sc expression was prepared by substitution of a fragment of C. albicans enolase coding sequence with a corresponding coding sequence fragment of S. cerevisiae enolase. The final recombinant coding sequence of C. albicans enolase with the coding sequence fragment of S. cerevisiae enolase (nucleotide sequence: AAGGCTGCTGGTCACGACGGTAAGATCAAGATCGGTTTGGACTGTGCTTCCTCTGAATTCTTC, amino acid sequence: ₂₃₄KAAGHDGKIKIGLDCASSEFF₂₅₄), together with a fragment encoding the WELQut protease cleavage site upstream of the enolase coding sequence, was synthesized and cloned into the existing open reading frame of the pETDuet-1 vector between the BamHI and XhoI restriction sites (GenScript, Piscataway Township, NJ, USA). The obtained plasmid construct was used for bacterial transformation and positive transformants were selected. The plasmid was isolated using a Plasmid Mini Kit (A&A Biotechnology) and used to transform chemically competent RosettaTM 2 (DE3) cells (Novagen). The further steps taken in relation to protein expression and purification were analogous to those used for C. albicans recombinant enolase (R-Eno).

Codon optimized genes for the mazEF6 TA system were PCR amplified from the pET Duet-1 vector, which was synthesized from GenScript (United States). PCR amplified products were gel purified and in vitro recombined using Gibson assembly with either pET-15b vector for MazF6 protein purification, or pPNLS vector for MazE6 yeast surface display (Gibson et al., 2009 (link)). Recombined products were transformed into E. coli and plasmid identities were confirmed by Sanger sequencing.
For generation of mutants of MazE6 protein, the mazE6 gene was amplified in two fragments with the desired point mutations. The fragments had overlapping regions (introduced during PCR) of 25-30 nucleotides, which were then recombined in vivo with pPNLS vector in EBY100 strain of Saccharomyces cerevisiae. We have used GAC and CGC codons (most common D and R codons in M. tuberculosis H37Rv genome) for all Asp (D) and Arg (R) mutagenesis respectively. We have individually cloned the WT and all the Asp and Arg mutants of MazE6 by setting up individual reactions for each clone. Amplification was done using Phusion Polymerase from NEB as per the manufacturer’s protocol. Plasmid was isolated and PCR amplified, and mutations were confirmed by Sanger sequencing. Upon Sanger sequencing, 43 aspartate and 27 arginine mutants were sequence confirmed, which were then used in this study.