T3 rna polymerase

Reporters were linearized with BamHI, purified using the EZ-10 spin column DNA Cleanup Miniprep Kit (BioBasic, BS367) and 3 μg was transcribed with T3 RNA polymerase (NEB, M0378), 10× RNA polymerase buffer (NEB), 0.5 mM CTP, 0.5 mM ATP, 0.5 mM UTP, 0.1 mM GTP, 0.5 mM 3′-O-Me-^m7GpppG (Anti-Reverse Cap Analog [ARCA]; NEB, S1411), 100 U RNase Inhibitor (NEB, M0307) in a volume of 100 μl for 3 h at 37°C. DNaseI (5U, NEB, M0303) was then added, and samples were incubated for an additional 30 min at 37°C. Standard phenol/chloroform extraction was performed. Samples were then purified through G-50 Sephadex columns followed by precipitation with ethanol and NH₄OAc, and re-suspended in water. RNA was then quantified using a Nanodrop and stored at −80°C.

Capped messenger RNA (mRNA) was synthetized using either T3 or SP6 mMessage Machine (Life Technologies, Carlsbad, CA, USA) following manufacturer instructions from pENTR in which S. Cerevisiae was cloned using Gateway Technology (Life Technologies, Primers: F: CACC ATGGGAAAGCCAAAAAGAAGAG and R: TCAGTAAAGGTTTTTCACC). RNA probes for in situ hybridization were transcribed with either T7, SP6 or T3 RNA Polymerase (New England Biolabs, Ipswich, MA, USA) and labeled with DIG (Roche, Basel, Switzerland) following manufacturer instructions. One-cell stage eggs were microinjected with 10 nL of 0.75 mg/mL of Elp3 (translation-blocking 5′TGGCTTTCCCATCTTAGACACAAT, splicing blocking 5′CTCAAGTCACCTGACGTATAAAACAC) or control morpholino (5′ CTAACACAGATTCTACCCTTTCGGT) diluted in Danieaux buffer.

FAM230B and negative control RNAs used in this assay were in vitro transcripts prepared using T3 RNA Polymerase (NEB). The 3′ end of both RNAs were biotinylated using Pierce™ RNA 3′ End Biotinylation Kit (Thermal Fisher). These two labeled RNAs (Bio-xx and Bio-NC) were transfected into cells using the method mentioned above. Cells were collected 48 h later and cell lysates were prepared by incubating the cells with cell lysis buffer on ice for 20 min. After that, Dynabeads M-280 Streptavidin (Invitrogen) was used to incubate with cell lysates to pull down RNA complex. After RNA purification, RT-qPCR was carried out to determine the expression of premature miR-1182.

Calf intestinal alkaline phosphatase (CIP), T3 RNA polymerase, “High Fidelity” (PvuII and EcoRI) and other restriction enzymes, T4 polynt kinase (PNK), and MuLV RT were from New England Biolabs. DNase (deoxyribonuclease)-free RNase (ribonuclease), ribonucleotides, and deoxyribonucleotides were obtained from Roche. RNase free-DNase I was from United States Biochemical. Rapid DNA ligation kit, RNasin (RNase inhibitor), and the phiX174 HinfI digest DNA ladder was from Promega. Radiolabeled compounds were from PerkinElmer. Pfu DNA polymerase was from Stratagene. DNA oligonucleotides were from Integrated DNA Technologies. G-25 spin columns were from Harvard Apparatus. RNeasy RNA purification and the Plasmid DNA Miniprep kits were from Qiagen. X-gal was from Denville Scientific, Inc. IPTG and media were from Gibco, Life Technologies. All other chemicals were obtained from Fisher Scientific, VWR, or Sigma. HIV RT (from HXB2 strain) was prepared as described [64 (link)]. The HIV RT clone was a generous gift from Dr. Michael Parniak (University of Pittsburgh). This enzyme is a non-tagged heterodimer consisting of equal proportions of p66 and p51 subunits. Aliquots of HIV RT were stored frozen at −80°C and fresh aliquots were used for each experiment.