Sybr green premix ex taq

Manufactured by Takara Bio

Sourced in Japan, United States, China, Switzerland, Germany

SYBR Green Premix Ex Taq is a ready-to-use solution for real-time PCR amplification. It contains SYBR Green I dye, DNA polymerase, dNTPs, and necessary buffers and reagents for efficient and sensitive detection of target DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

323 protocols using sybr green premix ex taq

Transcriptome Analysis by RNA-Seq

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted by TRIzol reagent (Invitrogen).
RNA was reverse‐transcribed into cDNA using a first strand cDNA synthesis kit (Invitrogen). Quantitative RT‐PCR was performed using an ABI StepOne Plus using SYBR Green® Premix Ex Taq (Takara).
The total RNA of each sample was used using an Invitrogen SuperScript double‐stranded cDNA synthesis kit. Double‐stranded cDNA was executed with a NimbleGen one‐colour DNA labelling kit and then executed for array hybridisation by using the NimbleGen hybridisation system and washing with the NimbleGen wash buffer kit. Axon GenePix 4000 B microarray scanner (Molecular Devices) was used for scanning.

Shao Y., Xu Y., Di H., Shi X., Wang Y., Liu H, & Song L. (2023). The inhibition of ORMDL3 prevents Alzheimer's disease through ferroptosis by PERK/ATF4/HSPA5 pathway. IET Nanobiotechnology, 17(3), 182-196.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

After 3 washes with phosphate-buffered saline (PBS), TRIzol (Thermo) was used to extract total RNA from the cells. RNA was reverse transcribed into complementary DNA using a PrimeScript RT Reagent Kit (TaKaRa). qRT–PCR was performed using SYBR Green Premix Ex Taq (TaKaRa) according to the manufacturer's protocol. A real-time PCR system was used to detect the gene expression levels, and the relative expression was analysed and calculated using the 2^−ΔΔCt method, with GAPDH serving as the normalization control. Primers were designed. The primers used for detecting mRNA expression in our study are shown in Supplementary Table S1.

Zhang Y., Liu W., Yuan W., Cai Z., Ye G., Zheng G., Xu C., Wang X., zeng C., Mi R., Feng P., Chen F., Wu Y., Shen H, & Wang P. (2022). Impairment of APPL1/Myoferlin facilitates adipogenic differentiation of mesenchymal stem cells by blocking autophagy flux in osteoporosis. Cellular and Molecular Life Sciences, 79(9), 488.

+ Open protocol

+ Expand

Quantification of Liver Parasite Burden

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole livers were obtained from the vaccine-protected mice in the challenge study promptly after the animals were sacrificed. Each liver was placed in a 5-ml plastic tube containing 4.0 ml of ALT buffer (Qiagen, Valencia, CA, USA), and then homogenized at 2,500 rpm for 3.5 min using a μT-12 bead crusher (Tatitec, Saitama, Japan). Total DNA was isolated from 100-µl aliquots of the resulting homogenates using a DNA isolation kit (Qiagen) in accordance with the manufacturer’s instructions. A quantitative analysis of the DNA was performed by qPCR with SYBR Green Premix Ex Taq (Takara, Tokyo, Japan). The oligonucleotide primers used for qPCR are shown in Supplemental Table 1. pAAV-CMV-sPfCSP2-G(+) plasmid DNA was used to generate a standard curve for the qPCR assays targeting the pfcsp gene sequences. A C_t cutoff was determined for each assay, whereby any well with a C_t value ≥ the mean C_q of the 10³ standard was omitted from the analysis because it would lie outside of the linear range of the assay. The fit-points method for absolute quantification was used for the analysis, and the noise band and threshold were set to Auto (18 (link)).

Shahnaij M., Iyori M., Mizukami H., Kajino M., Yamagoshi I., Syafira I., Yusuf Y., Fujiwara K., Yamamoto D.S., Kato H., Ohno N, & Yoshida S. (2021). Liver-Directed AAV8 Booster Vaccine Expressing Plasmodium falciparum Antigen Following Adenovirus Vaccine Priming Elicits Sterile Protection in a Murine Model. Frontiers in Immunology, 12, 612910.

+ Open protocol

+ Expand

Real-Time PCR Analysis of Intestinal Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

According to previously described methods (Wang Y. Y. et al., 2021 (link)), total RNA was extracted from powdered frozen intestinal mucosa (RNAiso Plus reagent, TAKARA, Tokyo, Japan) and reverse-transcribed using M-MLV reverse transcriptase (Takara Bio). Real-Time PCR was performed using SYBR^® Green Premix Ex Taq™ (Takara) and the ABI 7500 Fast Real-Time PCR system (Applied Biosystems, Carlsbad, CA, United States). The primers used are shown in Table 2. Results were normalized to the abundance of β-actin transcripts and relative quantification was calculated using the 2^−ΔΔCT method.

Wang Y., Xu Y., Cao G., Zhou X., Wang Q., Fu A, & Zhan X. (2023). Bacillus subtilis DSM29784 attenuates Clostridium perfringens-induced intestinal damage of broilers by modulating intestinal microbiota and the metabolome. Frontiers in Microbiology, 14, 1138903.

+ Open protocol

+ Expand

Quantifying Angiotensin Receptor Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the SN with Trizol (Invitrogen, Inc.) according to the manufacturer's guidelines. Equal amounts of total RNA were reverse transcribed with the PrimeScript^TM RT Master Mix (Takara Bio Inc) under standard conditions as described [31 (link)]. Subsequently, quantitative real-time PCR reactions were performed with SYBR Green Premix Ex Taq (Takara Bio Inc) and specific primers to detect AT1R and AT2R expressions. Meanwhile, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was adopted as an internal control, as its expression showed minimal variation in different tissues. Primers sequences: for AT1R: forward 5′-TTCAACCTCTACGCCAGTGTG-3′, reverse 5′-GCCAAGCCAGCCATCAGC-3′, for AT2R: forward 5′-AACATCTGCTGAAGACCAATAG-3′, reverse 5′-AGAAGGTCAGAACATGGAAGG-3′, for GAPDH: forward 5′-TGCCACTCAGAAGACTGTGG-3′, reverse 5′-TTCAGCTCTGGGATGACCTT-3′.

Gao Q., Ou Z., Jiang T., Tian Y.Y., Zhou J.S., Wu L., Shi J.Q, & Zhang Y.D. (2017). Azilsartan ameliorates apoptosis of dopaminergic neurons and rescues characteristic parkinsonian behaviors in a rat model of Parkinson’s disease. Oncotarget, 8(15), 24099-24109.

+ Open protocol

+ Expand

Quantification of miRNA Expression by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total miRNAs were isolated using mirVana miRNA Isolation Kit (Ambion, Austin, TX, USA), followed by reverse transcriptions using Takara RNA PCR kit (Takara Biotechnology, Dalian, China). To quantify the transcriptional levels of the certain genes, real-time PCR was performed using a SYBR Green Premix Ex Taq (Takara, Dalian, China) according to the product specification. Relative expression levels of the miRNA were normalized to that of RNU6, which was routinely used as an internal or endogenous control for miRNA expression. The primers used in qRT-PCR were purchased from RiboBio (RiboBio, China) and the reaction was performed according to the manufacturer’s instructions.

Zhang H., Zhang X., Yuan X., Wang L, & Xiao Y. (2015). MicroRNA-205 inhibits renal cells apoptosis via targeting CMTM4. Iranian Journal of Basic Medical Sciences, 18(10), 1020-1026.

+ Open protocol

+ Expand

Quantifying miR-sc8 and EGFR Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was reversely transcribed to determine the expression of miR-sc8 (forward primer: 5' CGGTGAGGATTACGAAGAGGA 3' and reverse primer: 5' GTGCAGGGTCCGAGGT 3') using TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems) and stem-loop RT primer (5' GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCATC 3'). Total RNA samples were also reverse transcribed to cDNA using a prime-script reagent kit (TaKaRa, Dalian, China) to detect the expression of Egfr (forward primer: 5' CCCAACTAGGCACCTTTGAAG 3' and reverse primer: 5' GATGATCTGCAGGTTCTCCAAAG 3'). Quantitative real-time PCR was performed using SYBR Green Premix Ex Taq (TaKaRa) on an Applied Biosystems Stepone real-time PCR System. Amplification reaction protocol was performed for 40 cycles of 95°C for 10 min, 95°C for 15 s, and 60°C for 1 min. The relative expression was calculated using the comparative 2^−ΔΔCt method.

Gu Y., Chen C., Yi S., Wang S., Gong L., Liu J., Gu X., Zhao Q, & Li S. (2015). miR-sc8 Inhibits Schwann Cell Proliferation and Migration by Targeting Egfr. PLoS ONE, 10(12), e0145185.

+ Open protocol

+ Expand

Real-time RT-PCR Analysis of hADSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

For real time RT-PCR analyses, cDNA was synthesized using total RNA which was previously prepared from primary hADSCs and NI-hADSCs using TRIzol protocol. Real time RT-PCR was performed with SYBR Green Premix Ex Taq (Takara Bio Inc.) and Thermal Cycler Dice Real Time System (Takara Bio Inc.). Each sample was analysed in four replicate reactions of 20 μL.

Jang S., Park J.S, & Jeong H.S. (2015). Neural Differentiation of Human Adipose Tissue-Derived Stem Cells Involves Activation of the Wnt5a/JNK Signalling. Stem Cells International, 2015, 178618.

+ Open protocol

+ Expand

Quantifying CD97 Expression in Endothelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the endothelial cells using an RNAsimple total RNA kit (Tiangen Biotech Co., Ltd., Beijing, China). First-strand cDNA was synthesized using a Primescript RT reagent kit (Takara Bio, Inc., Otsu, Japan). A total of 5 ng cDNA of each sample was subjected to PCR reactions consisting of 40 cycles of 95°C for 10 sec, 68°C for 30 sec and 72°C for 30 sec using SYBR-Green Premix Ex Taq (Takara Bio, Inc., Otsu, Japan) and detected by ABI PRISM 7500 Sequence Detection System (Thermo Fisher Scientific, Inc.). The relative expression level results were analyzed using the 2^−ΔΔCq method (20 (link)). Finally, the PCR products were examined using DNA agarose gel electrophoresis. The following primers were used for RT-PCR analysis: CD97, forward 5′-ACTCTGCCGGGAGCTGAAAC-3′ and reverse 5′-TGGATGGTGACCTCGGCTGA-3′; 18S, forward 5′-CCGCACTTGATACGGTTCCT-3′ and reverse 5′-CCAGGCTGATCTATCCCACTG-3′.

Zhao W., Wang Z., Sun Z., Wang S., Wu M, & Zheng L. (2017). Lentivirus-mediated overexpression of CD97/ADGRE5 reverses dysregulated high glucose-induced endothelial cell migration. Molecular Medicine Reports, 15(5), 3048-3054.

+ Open protocol

+ Expand

RT-qPCR Gene Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

For real time quantitative PCR (RT‐qPCR) assay, the total RNA of the cells was extracted and purified using an RNeasy Plus kit (Qiagen) following the manufacturer's instructions. For the reverse transcript, complementary DNA was synthesized using Takara RT Master Mix (Takara) following the manufacturer's instructions. The primers used for the RT‐qPCR assay were synthesized by Life Technologies (ThermoFisher Scientific) based on sequences retrieved from Primer Bank (http://pga.mgh.harvard.edu/primerbank/). SYBR Green Premix Ex Taq (Takara) was used for the amplification and detection of cDNA targets on a StepOne Plus Realtime PCR system (Applied Biosystems). The mean cycle threshold (Ct) value of each target gene was normalized to the housekeeping gene glyceraldehyde 3‐phosphate dehydrogenase (GAPDH). The results were shown in a fold change using the ∆∆Ct method.

Li W., Qiao W., Liu X., Bian D., Shen D., Zheng Y., Wu J., Kwan K.Y., Wong T.M., Cheung K.M, & Yeung K.W. (2021). Biomimicking Bone–Implant Interface Facilitates the Bioadaption of a New Degradable Magnesium Alloy to the Bone Tissue Microenvironment. Advanced Science, 8(23), 2102035.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!