Total RNA was extracted from murine ovary tissue using a TRIzol reagent kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. RNA (1 µg) was transcribed into cDNA using a PrimeScript™ RT reagent kit (Takara Biotechnology Co., Ltd., Dalian, China). qPCR reactions were performed using a Light Cycler Fast Start DNA Master SYBR-Green I kit and an ABI Prism 7300 Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.) The thermocycling conditions were as follows: 95°C for 3 min; 95°C for 15 sec; 60°C for 15 sec; 72°C for 1 min (35 cycles); and 72°C for 10 min. The relative expression of genes was determined using the 2−ΔΔCq method (19 (link)) with normalization to 36B4 expression. The primer sequences were as follows: LH receptor (LHR) forward, 5′-AATGAGTCCATCACGCTGAAAC-3′ and reverse, 5′-CCTGCAATTTGGTGGAAGAGA-3′; FSHR forward, 5′-CCTTGCTCCTGGTCTCCTTG-3′ and reverse, 5′-CTCGGTCACCTTGCTATCTTG-3′; aromatase forward, 5′-ATGTTCTTGGAAATGCTGAACCC-3′ and reverse, 5′-AGGACCTGGTATTGAAGACGAG-3′; peroxisome proliferator-activated receptor γ (PPARγ) forward, 5′-TTTTCCGAAGAACCATCCGATT-3′ and reverse, 5′-ATGGCATTGTGAGACATCCCC-3′; and 34B4 forward, 5′-AAGCGCGTCCTGGCATTGTCT-3′ and reverse, 5′-CCGCAGGGGCAGCAGTGGT-3′.
Lightcycler faststart dna master sybr green 1 kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The LightCycler FastStart DNA Master SYBR Green I kit is a reagent kit designed for real-time PCR analysis. It contains the necessary components, including SYBR Green I dye, for amplification and detection of DNA samples.
Automatically generated - may contain errors
Lab products found in correlation
Abi prism 7000 sequence detection system, by Thermo Fisher Scientific (3 mentions)
Abi prism 7300 sequence detection system, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Trizol reagent kit, by Thermo Fisher Scientific (1 mentions)
Lightcycler 2.0 system, by Roche (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Abi prism steponeplus sequence detection system, by Thermo Fisher Scientific (1 mentions)
10 protocols using lightcycler faststart dna master sybr green 1 kit
1
Quantifying Ovarian Gene Expression
2
Quantification of Subunit Expression in PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed with a Light Cycler 2.0 system (Roche) using the Light Cycler-Fast Start DNA Master SYBR Green I Kit (Applied Biosystems). We used the following sets of primers: β2 subunit forward: GAGCTTCGTTCCACAGCTTC and reverse: CCCACCAAACCGTCTAGA AA; β1 subunit forward: AGGCGTACGGTGAGAACATT and reverse: GGGAAAGATTTGTGCTTG TGA; β3 subunit forward: TCGAGTACTCCCCGTAACGA and reverse: AGGCTCTGGTTGAGGGAC TT; α1 forward: GAAGCAAGACGTCCTGGAAT and reverse: TTTCAGTCTTTCCGGGTGTT; α2 forward: CTACCCTGTTGCTTTGGCTTTC and reverse: TGAGGGACCTTAGCGGGAGA; and GAPDH forward: ACGGCACAGTCAAGGCTGAG and reverse: CAGCATCACCCCATTTGATGTTGG. PCRs were performed using 45 cycles that included the following steps: 30 s of denaturation at 95°C, a 30-s annealing phase at 60°C, and a 30-s template-dependent elongation phase at 72°C. The amplification of each DNA template was performed in at least three experiments with two technical replicates in the same PCR run. The differential gene expression of the investigated genes was calculated as the ratio normalized to the expression of the GAPDH gene. The data were analyzed using the equation described by Livak (Livak and Schmittgen, 2001 (link); amount of target = 2−ΔΔCT).
3
Renal mRNA Expression Analysis
4
Quantitative Gene Expression Analysis in Renal Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene expression in renal cortical tissue was analyzed by RT-PCR using a LightCycler FastStart DNA Master SYBR Green I kit and an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, USA) as described previously [18] (link), [23] (link). The oligonucleotide primer sequences for rat β-actin, TGF-β1, α-SMA, type 1 collagen, MCP-1, PAI-1, gp91phox, Nox-1, E-cadherin, and fibroblast-specific protein 1 (FSP-1) are listed in Table 1 . All data are expressed as the relative difference to the 10-week values of the DSS + NS group, after normalization to β-actin expression.
5
Placental Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the placentas using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA (1 μg) was used for reverse transcription using high-capacity cDNA of the reverse transcription kit RT (TaKaRa Biotechnology CO., Ltd) according to the manufacturer’s instructions. The PCNA, Cyclin D3, Slc38a1/SNAT1, Slc38a2/SNAT2, Slc38a4/SNAT4, TAUT, Slc2a1/GLUT1, Slc2a3/GLUT3 and GAPDH mRNA primer sequences were designed according to earlier publications15 (link)50 (link)51 (link). RT-qPCR was performed using a Light Cycler Fast Start DNA Master SYBR Green I Kit and an ABI Prism 7300 Sequence Detection System (Applied Biosystems, Foster City, California, USA), and relative gene expression was determined using the 2-ΔΔct method with normalization to GAPDH expression. The results were averaged from four sets of independent experiments.
6
Quantifying Gene Expression Profiles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression levels of glyceralde-hyde-3-phosphate dehydrogenase (GAPDH), renin, AT1R and AGT were analyzed by quantitative PCR using a Light Cycler Fast Start DNA Master SYBR Green I kit (Applied Biosystems, Foster City, CA, USA) in ABI PRISM 7900T real-time PCR system (Applied Biosystems). The primer sequences are shown in Table I . For the PCR, the conditions were as follows: 30 sec at 94°C; 40 cycles at 94°C for 5 sec, 55°C for 5 sec, and 72°C for 15 sec. All data are expressed as the relative differences following normalization to the GAPDH expression levels.
7
Quantification of mRNA Expression in Renal Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mRNA expression in renal cortical tissues was analysed by RT-PCR using a LightCycler FastStart DNA Master SYBR Green I kit and an ABI Prism 7,000 Sequence Detection System (Applied Biosystems, Foster City, USA) as previously described [15 (link), 35 (link)]. The oligonucleotide primer sequences for rat and human are listed in ESM Tables 1 and 2 , respectively. All data from in vivo studies are expressed as the relative difference in expression compared with LETO rats after normalisation for β-actin expression. Data from in vitro studies are expressed as the relative difference in expression compared with 5 mmol/l glucose after normalisation for β-actin expression.
8
Quantifying Kidney mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the regulation of mRNA expression under these conditions, mRNA was isolated from kidney tissue. A PCR System (7300 Fast Real-Time; Applied Biosystems, Foster City, CA, USA) and Light Cycler Fast Start DNA Master SYBR Green I kit (Applied Biosystems) were used to detect the levels of 18S and PAR-1 mRNA. Primer sequences were as follows: 18S—5′-GTAACCCGTTGAACCCCATT-3′, 5′-CCATCCAATCGGTAGTAGCG-3′; PAR-1—5′-GTTGATCGTTTCCACGGTCT-3′, 5′-GCTGCCTCTGTACCAGGACT-3′. Relative mRNA levels were determined using the 2−ΔΔCq method. The ΔΔCq value was calculated using data from the control group.
9
Quantifying Stress-Related Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hippocampus and PVN were collected from frozen brain slices (2 mm thick), and then stored at −80°C until assay. Total RNA was extracted from the PVN and hippocampus using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. One μg RNA was used for reverse transcription (TaKaRa, Shiga, Japan). The primer sequences were: rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH; NM_017008.4) sense: 5′-TCCCTCAAGATTGTCAGCAA-3′, and antisense: 5′-AGATCCACAACGGATACATT-3′; rat corticotropin-releasing hormone (CRH; NM_031019.1) sense: 5′-CAGAACAACAGTGCGGGCTCA-3′, and antisense: 5′-AAGGCAGACAGGGCGACAGAG-3′; rat MR (NM_013131.1) sense: 5′-TGTCTCAGACCTTGGAGCGTT-3′, and antisense: 5′-TGTTCGGAATAGCACCGGAA-3′; rat GR (AB115420.1) sense: 5′-ACAGCTCACCCCTACCTTGGT-3′, and antisense: 5′-CTTGACGCCCACCTAACATGT-3′. RT-PCR was performed using a Light Cycler Fast Start DNA Master SYBR Green I kit and ABI Prism Step One Plus Sequence Detection System (Applied Biosystems, Foster City, CA, USA) and relative expression of genes was determined using the 2-ΔΔCt method by normalization against GAPDH expression. The relative levels of CRH, MR and GR mRNA were expressed as percent of control value.
10
Renal mRNA Expression Analysis by qPCR
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!