Qbase software

Expression of three miRNAs (bta-miR-100: AACCCGTAGATCCGAACTTGT, bta-miR-16a: TAGCAGCACGTAAATATTGGCG and bta-chr27-30001: CGCCGGGGCGGGTTCCGGAGG) as well as two bta-miR-191 isomiRs (CAACGGAATCCCAAAAGC and CAACGGAATCCCAAAAGCAG) was assessed by RT-qPCR on 3 testis parenchyma sperm and 3 ejaculated sperm samples to evaluate their differential expression. LNA primers were supplied by Qiagen. Duplicates were assayed in 10-μl/5-ng qPCR reactions following the miRCURY LNA kit protocol, using a StepOnePlus Real-Time PCR System (Applied biosystems). Amplification curves were analyzed using the StepOne software v2.3 to compute Ct values and analyze the melting curve. Relative expression was computed with the qbase⁺ software (Biogazelle).

Each RT-qPCR mixture contained 5 μL GoTaq qPCR Master Mix (Promega, Wisconsin, USA), 2 μL cDNA (diluted 20×), 2.6 μL nuclease-free water, and 0.4 μL of each forward and reverse primer (10 µm). AgRPS26 and AgRPS11 were used as reference genes. RT-qPCR was performed on a CFX96 Touch Real-Time PCR Detection System (Bio-Rad, California, United States) under the following conditions: initial denaturation at 95°C for 15 min, followed by 40 cycles of 95°C for 30 s, 60°C for 20 s, and 72°C for 30 s. Primer efficiency was calculated using the MINER software, and relative gene expression analysis was performed following the 2^−ΔΔCt method (Pfaffl, 2001 (link)) using the qbase⁺ software (Biogazelle, Gent, Belgium). The primers employed for the gene expression analysis are listed in Supplementary Table S1.

Total RNA was extracted from the nasopharynx using flocked swabs and a 1 mL viral transport medium (various vendors). RNA was extracted using an in-house method adapted from He et al. [17 (link)] using Sera-Mag beads (GE Healthcare, Chicago, IL, USA). Real-time RT-PCR was performed according to the diagnostic detection of Wuhan coronavirus 2019 by real-time RT-PCR [18 (link)]. RdRp, E, and human RNAseP assays were run in separate real-time RT-PCR reactions using a GB OneStep IPC Elite real-time RT-PCR Kit (Generi Biotech, Hradec Kralove, Czech Republic), which employs an internal positive control for the detection of PCR inhibition. For relative quantification of the viral titer in positive samples, the E gene assay results were normalized to hsa-mir-148a housekeeping miRNA. The reverse transcription and real-time PCR conditions for the hsa-mir-148a assay were, except for the fact that the RNA was not diluted, the same as described below in the validation of miRNA expression profiles by real-time RT-PCR section. The relative quantity of viral titer was calculated according to the 2^−ΔΔCt method [19 (link)] by using the qBase+ software (Biogazelle, Zwijnaarde, Belgium). In total, the study was conducted on 10 SARS-CoV-2-positive (PosS) and 10 SARS-CoV-2-negative (NegS) RNA samples listed in Table 1.

A StepOne Plus system (Thermo Scientific) was used for RT-qPCR using TaqMan fast advanced master mix and gene expression assays (see Table S1). Data normalization was done against the mean of the reference genes glyceraldehyde-3-phosphate dehydrogenase (Gapdh), hydroxymethylbilane synthase (Hmbs) and ubiquitin C (Ubc) using qbase+ software (Biogazelle, Zwijnaarde, Belgium).

mRNA levels of BCAA metabolizing enzyme related genes in SAT and AA tissues were measured by quantitative PCR by employing optimal reference gene pairs which was validated as previously described (39 (link)). Primer information used for the study are provided in Table 8. Powdered tissue samples were homogenized in Ribozol (N580-CA, Amresco, OH, USA). RNA was isolated as per the manufacturer's instructions and QIAxcel Advanced System (Qiagen, Toronto, ON) was used to determine the RNA quality and quantity. One microgram of RNA of was used to synthesize cDNA using qScript cDNA supermix (CA101414-104, Quanta Biosciences). qPCR analysis was performed using PerfeCTa SYBR green Supermix Low ROX (Quanta Biosciences, MA, USA) and a ViiA7 real-time PCR machine (Thermo Fisher Scientific, CA, USA) as detailed previously (39 (link)). qBase + software (Biogazelle) was used to quantify mRNA expression (39 (link)).

Telomere length was assessed by using a modified real-time PCR method [53 (link)]. In brief, for each sample in triplicate, the telomeric region was amplified with the use of telomere specific primers (telg and telc) and one single-copy gene was amplified (36B4) on a 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA) in a 384-well format, specifications on PCR mixtures and cycling conditions are provided elsewhere [9 (link)]. After the amplification of the telomere specific region cycle thresholds were normalized relative to the cycle thresholds after the amplification of the single-copy gene using the qBase software (Biogazelle, Zwijnaarde, Belgium). Relative average placental telomere lengths were expressed as the ratio of telomere copy number to single copy gene number (T/S) relative to the average T/S ratio of the entire sample set. Reaction efficiency was assessed on each reaction plate (using a 6-point serial dilution of pooled placental DNA) and six different placental DNA samples were used as inter-run calibrators (IRCs) to account for inter-run variability. Negative controls (non-template controls) were also used in each run. We achieved coefficients of variation (CVs) of 0.55%, 0.35% and 7.1% for telomere runs, single-copy gene runs and T/S ratios, respectively.