Abi prism 3500 genetic analyzer

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany

The ABI Prism 3500 Genetic Analyzer is a capillary electrophoresis-based DNA sequencing system. It is designed to perform DNA fragment analysis, DNA sequencing, and other genetic applications. The instrument uses laser-induced fluorescence detection to analyze DNA samples.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

3500 Genetic Analyzer (469 citations) ABI 3500 Genetic Analyzer (429 citations) ABI 3500 (109 citations) ABI PRISM 3500 (37 citations) ABI Prism Genetic Analyzer (31 citations) ABI 3500 analyzer (7 citations) ABI PRISM 3500 × l genetic analyzer (3 citations) ABI PRISM 3500 analyzer (2 citations) ABI Prism 3500 × 1 Genetic Analyzer (2 citations) ABI PRISM 3130/3500 Genetic Analyzer (2 citations)

119 protocols using abi prism 3500 genetic analyzer

SARS-CoV-2 Spike Partial Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

Partial sequencing of the Spike segment was performed by Sanger sequencing in samples with incomplete genome or samples with cycle threshold (Ct) values above 28. Briefly, 956 bp amplicons (944–1900 nucleotide sequence, 315–633 aa) were obtained using specific primers for SARS-CoV-2:
SF3 CTTCTAACTTTAGAGTCCAACC and SR4 GCCAAGTAGGAGTAAGTTGAT.
The amplicons were sequenced in both directions with the same primers. Sequencing reactions were performed with a BigDye Terminator v3.1 (Life Technologies, Carlsbad, CA, USA) as instructed by the manufacturer. Sequences were obtained by capillary electrophoresis using an ABI Prism 3500 Genetic Analyzer (Life Technologies) and were assembled using MEGA 10.0 [21 (link)]. The sequences mentioned above can be found at GenBank (accession numbers: ON158371–ON158443).

Hernández-Terán A., Garcíadiego-Fossas P., Villanueva-Reza M., Boukadida C., Taboada B., Porras E., Ahumada-Topete V., Tapia-Diaz K.E., Matías-Florentino M., Pérez-García M., Ávila-Ríos S., Mejía-Nepomuceno F., Serna-Muñoz R., Juárez-Hernández F., Jiménez-Corona M.E., Becerril-Vargas E., Barreto O., Martínez-Orozco J.A., Pérez-Padilla R., Arias C.F, & Vázquez-Pérez J.A. (2022). Clinical and Virological Features of Patients Hospitalized with Different Types of COVID-19 Vaccination in Mexico City. Vaccines, 10(8), 1181.

+ Open protocol

+ Expand

VP1 Partial Sequencing from Respiratory Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Partial sequencing of the VP1 was performed in 15 patients, directly from respiratory samples. Briefly, 519‐bp amplicons were obtained using specific primers for VP1 (Table 1) in 25 μl reactions using the OneStep RT‐PCR Kit (QIAGEN, Valencia, CA). The amplicons were sequenced in both directions with the same primers. Sequencing reactions were performed with BigDye Terminator v3·1 (Life Technologies, Carlsbad, CA, USA) as indicated by the manufacturer. Sequences were obtained by capillary electrophoresis using an ABI Prism 3500 Genetic Analyzer (Life Technologies) and were assembled using MEGA 5·0·5. The aforementioned sequences can be found at GenBank (KR081323‐KR081333 and KT382190‐KT382193).

Vazquez‐Perez J.A., Ramirez‐Gonzalez J.E., Moreno‐Valencia Y., Hernandez‐Hernandez V.A., Romero‐Espinoza J.A., Castillejos‐Lopez M., Hernandez A., Perez‐Padilla R., Oropeza‐Lopez L.E., Escobar‐Escamilla N., Gonzalez‐Villa M., Alejandre‐Garcia A., Regalado‐Pineda J., Santillan‐Doherty P., Lopez‐Martínez I., Diaz‐Quiñonez A, & Salas‐Hernandez J. (2016). EV‐D68 infection in children with asthma exacerbation and pneumonia in Mexico City during 2014 autumn. Influenza and Other Respiratory Viruses, 10(3), 154-160.

+ Open protocol

+ Expand

HIV-1 pol Gene Genotyping Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genotyping of the full protease gene and partial reverse transcriptase regions of the HIV-1 pol gene was done using a modified and validated in-house method²² (link) at the MRC/UVRI and LSHTM laboratory, which is a WHO HIVResNet-designated reference laboratory for HIVDR genotyping. The 1300 bp segment of the 5′ region of the pol gene was generated by RT–PCR, followed by nested PCR using total nucleic acid extracted from DBS or plasma. The fragment was purified, sequenced using a BigDye Terminator v3.1 cycle sequencing kit (Life Technologies, Foster City, CA, USA) and analysed on an ABI Prism 3500 Genetic Analyzer (Life Technologies). A combination of the Sequencher software (Sequencher^® v5.4.1 sequence analysis software, Gene Codes Corporation, Ann Arbor, MI, USA) and a customized RECall software program²³ (link) was used to edit the raw sequence data and generate consensus sequences. DRMs were analysed using the Stanford HIVdb program according to the 2009 WHO mutation list.²⁴ (link) For quality control purposes, our laboratory is enrolled in the Virology Quality Assurance programme funded by the National Institutes of Health located in Baltimore, MD, USA. All sequences generated in the laboratory are assessed for cross-contamination by phylogenetic analysis. Sequences from this study were deposited in GenBank under accession numbers MN625980–6330.

Watera C., Ssemwanga D., Namayanja G., Asio J., Lutalo T., Namale A., Sanyu G., Ssewanyana I., Gonzalez-Salazar J.F., Nazziwa J., Nanyonjo M., Raizes E., Kabuga U., Mwangi C., Kirungi W., Musinguzi J., Mugagga K., Mbidde E.K, & Kaleebu P. (2021). HIV drug resistance among adults initiating antiretroviral therapy in Uganda. Journal of Antimicrobial Chemotherapy, 76(9), 2407-2414.

+ Open protocol

+ Expand

MODY Gene Variant Analysis Protocol

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

All patients were informed in person and their written consent was obtained. Genomic DNA was isolated from peripheral blood leucocytes using the QIAamp DNA Blood Mini QIAcube Kit (Qiagen, Hilden, Germany), according to the manufacturer’s protocols. All coding exons and exon-intron boundaries of seven genes that were associated with MODY (
KCNJ11, ABCC8, INS, GCK, HNF4A, HNF1A, HNF1B) were amplified using the Multiplicom MODY MasterDx (Agilent, CA, USA) kit. Prepared library was sequenced on the Illumina Miseq platform (Illumina Inc., San Diego, CA, USA). The data were analyzed by the Sophia DDM data analysis software. In order to call variants, sequencing data was aligned to human reference genome, hg19. After amplifying targeted regions using designed primers, Sanger sequencing on ABI Prism 3500 Genetic Analyzer (Thermo Fisher Scientific, MA USA) was performed for the confirmation of the detected variants and segregation analysis. Novel variations were classified according to the American College of Medical Genetics and Genomics criteria (
20 (link)
). Mutation Taster, The Sorting Intolerant from Tolerant (SIFT) and deleterious annotation of genetic variants using neural networks (DANN) were used for computational pathogenicity prediction (
21 (link)
). The data of minor allele frequencies of variants were obtained from GnomAD (
22 (link)
).

Üstay Ö., Ateş E.A., Apaydin T., Elbasan O., Polat H., Günhan G., Dinçer C., Şeker L., Yabacı A., Güney A.I, & Yavuz D.G. (2022). When do we need to suspect maturity onset diabetes of the young in patients with type 2 diabetes mellitus?. Archives of Endocrinology and Metabolism, 66(1), 32-39.

+ Open protocol

+ Expand

Ovine Tissue RNA Extraction and RT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from each tissue was extracted using TRIzol (Thermo Fisher Scientific, Waltham, MA, USA) or TRIsure reagent (Bioline, Luckenwalde, Germany). Total RNA of ovine testis and adrenal was purchased from Zyagnen (San Diego, CA, USA). RT-PCR was performed as described [24 (link),25 (link),26 (link)]. The cDNA was synthesized from total RNA of each tissue using random hexamers and SuperScript III Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). PCR was performed using Ex Taq (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions. The reaction products of the RT-PCR assay were subjected to electrophoresis in a 1.25% agar gel, and the resulting bands were visualized by staining with ethidium bromide. The primers used for PCR are described in Table S1. To identify the ORF of ovine HSD17B3, the PCR product obtained using testis cDNA as template was cloned into the pGEM-T Easy Vector (Promega Cooperation, Madison, Woods Hollow Road Madison, WI, USA) and sequenced on an ABI PRISM 3500 Genetic Analyzer with a Big-Dye Sequencing Kit version 3.1 (Thermo Fisher Scientific, Waltham, MA, USA), using universal primers (SP6 and T7).

Islam M.S., Uwada J., Hayashi J., Kikuya K.I., Muranishi Y., Watanabe H., Yaegashi K., Hasegawa K., Ida T., Sato T., Imamichi Y., Kitano T., Miyashiro Y., Khan R.I., Takahashi S., Umezawa A., Suzuki N., Sekiguchi T, & Yazawa T. (2021). Analyses of Molecular Characteristics and Enzymatic Activities of Ovine HSD17B3. Animals : an Open Access Journal from MDPI, 11(10), 2876.

+ Open protocol

+ Expand

Site-directed and Random Mutagenesis of LAAO/MOG

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mutations were introduced by PCR using expression plasmid pET15b‐laao/mog as a template and the QuikChange kit (Stratagene, La Jolla, CA, USA) using primers P1 to P10 (Table S1). For site‐directed mutagenesis, both a direct and a reverse primer were designed complementary to opposite strands of the same DNA region. The mutated genes were completely sequenced using an ABI PRISM 3500 genetic analyzer (Thermo Fisher Scientific, Waltham, MA, USA) to ensure that only the desired mutations were introduced. Each colony was cultivated in a 96‐well plate, and crude extracts were prepared using BugBuster reagent (Merck Millipore, Billerica, MA, USA).
Random mutagenesis was introduced using primers P11 and P12 (Table S1), in which target amino acid positions were replaced with a degenerate codon, NNS (N = ATGC, S = GC). Each colony was cultivated in a 96‐well plate, and crude extracts were prepared using BugBuster reagent (Merck Millipore). We screened 384 colonies (4 plates), and the library size was more than 10 times larger than the number of possible 32 cases by the NNS codon.

Im D., Matsui D., Arakawa T., Isobe K., Asano Y, & Fushinobu S. (2018). Ligand complex structures of l‐amino acid oxidase/monooxygenase from Pseudomonas sp. AIU 813 and its conformational change. FEBS Open Bio, 8(3), 314-324.

+ Open protocol

+ Expand

Sanger Sequencing Procedure

Check if the same lab product or an alternative is used in the 5 most similar protocols

Sequence analysis was performed using an Applied Biosystems BigDye™ terminator kit (BigDye Terminator v1.1 cycle sequencing kit, ThermoFischer), and the ABI Prism 3500 Genetic Analyzer (ThermoFischer), according to the manufacturer's instructions.

Boukthir S., Gaudu P., Faili A, & Kayal S. (2023). pBFK, a new thermosensitive shuttle vector for Streptococcus pyogenes gene deletion by homologous recombination. Heliyon, 9(6), e16720.

+ Open protocol

+ Expand

Genetic Profiling of HCS-Associated Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

We sequenced 25 genes associated with HCSs (ATM, BARD1, BRCA1, BRCA2, BRIP1, CDH1, CHEK2, FAM175A, MRE11A, NBN, PALB2, PIK3CA, RAD50, RAD51C, RAD51D, TP53, XRCC2, MLH1, MSH2, MSH6, PMS2, APC, MUTYH, PTEN, and STK11) in the Ilumina NextSeq platform (Illumina Inc., San Diego, CA, USA) using the HCS_v1 kit (SOPHiA Genetics, Boston USA) after DNA isolation from peripheral blood samples taken with an EDTA tube and obtaining informed consent from the patients. The data obtained were analyzed in Sophia DDM analysis program. To compare variants, sequencing data was aligned to human reference genome, hg19. Regarding the confirmation and segregation analysis of the detected variants, the target region was replicated with the designed primers and then sequenced with the ABI Prism 3500 Genetic Analyzer (Thermo Fisher Scientific, MA USA) device by the Sanger sequencing method. The Human Gene Mutation Database Professional (HGMD, 2020) and ClinVar databases were screened for the known variations, and novel variants detected in the study were evaluated according to American College of Medical Genetics and Genomics criteria^{8 (link),9 (link),10 (link)}.

ARSLAN ATES E., TURKYILMAZ A., ALAVANDA C., YILDIRIM O, & GUNEY A.I. (2022). Multigene Panel Testing in Turkish Hereditary Cancer Syndrome Patients. Medeniyet Medical Journal, 37(2), 150-158.

+ Open protocol

+ Expand

Sanger Sequencing Protocol Using BigDye Terminator

Check if the same lab product or an alternative is used in the 5 most similar protocols

The sequencing reaction was prepared with a BigDye™ Terminator v3.1 Cycler Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA). Either 2.5 µL of genomic DNA amplificate or 200–300 ng plasmid, 2 mL Premix, 1.5 µL 2.5 µM forward primer, and 4 µL BigDye buffer (5×) were filled up with water to a total volume of 20 µL for each sequencing reaction. Initial denaturation for 2 min at 95 °C was followed by 30 cycles of denaturation (10 s, 95 °C), annealing (10 s, primer-specific annealing temperature), and elongation (4 min, 60 °C). Reaction mixture purification was achieved by 4 min centrifugation at 1000× g on a 750 µL Sephadex™ G-50 column (Sigma-Aldrich, St. Louis, MO, USA). Sanger Sequencing was performed on an ABI Prism 3500 Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA).

Plümers R., Osterhage M.R., Lindenkamp C., Knabbe C, & Hendig D. (2022). Targeting ABCC6 in Mesenchymal Stem Cells: Impairment of Mature Adipocyte Lipid Homeostasis. International Journal of Molecular Sciences, 23(16), 9218.

+ Open protocol

+ Expand

DNA Extraction and Genotyping of AIMs

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was isolated from buccal swabs with the ChargeSwitch® gDNA Normalized Buccal Cell Kit (Invitrogen) and 1 µl of each DNA extract (1-3 ng) was used in the following PCR experiments. A total of 77 AIMs were tested comprising: 46 AIM-Indels (herein, "46-I"), amplified according to the J o u r n a l P r e -p r o o f multiplex PCR protocol previously described by Pereira et al. [17] ; 31 SNPs ("Global AIMs Nano set", herein, "31-N") amplified according to the multiplex PCR and single base extension (SBE) protocols described by de la Puente et al. [18] . Detection and separation of PCR and SBE products were carried out using the ABI Prism 3500 Genetic Analyzer and GeneMapper ID software v5.1 (Thermo Fisher Scientific).

Kumar H.R.S., Haddish K., Lacerenza D., Aneli S., Di Gaetano C., Tewelemedhin G., Manukonda R.V., Futwi N., Alvarez-Iglesias V., de la Puente M., Fondevila M., Lareu M.V., Phillips C, & Robino C. (2020). Characterization of ancestry informative markers in the Tigray population of Ethiopia: A contribution to the identification process of dead migrants in the Mediterranean Sea. Forensic science international. Genetics, 45.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!