The largest database of trusted experimental protocols

C57bl 6jgpt mice

Manufactured by GemPharmatech
Sourced in China

The C57BL/6JGpt mice are a laboratory mouse strain. They are widely used in biomedical research.

Automatically generated - may contain errors

7 protocols using c57bl 6jgpt mice

1

Mouse Models for Stroke Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
According to the Stroke Therapy Academic Industry Roundtable (STAIR) recommendations, young male, female, aged mice, and mice with comorbid conditions were used in this study [12 (link), 13 (link)]. Male C57BL/6JGpt mice (8-week-old male mice, weighing 23–25 g), old C57BL/6JGpt mice (12-month-old male mice, weighing 30–34 g), female mice (8-week-old male mice, weighing 23–25 g), High-Fat Diet-Induced Obese (DIO) male mice (14-week-old male mice fed with high-fat diet [60 kcal % Fat] for 8 weeks to induce obesity, weighing 40–43 g) and C57BL/6JGpt mouse embryos (E17-18) were obtained from the Gempharmatech Co. All experimental procedures in the present study were approved by the Institutional Animal Care and Use Committees at Southeast University and performed at a pathogen-free facility. The number of animals was determined by a power analysis based on our previous experience with variance in outcomes and effect sizes in the tMCAO or dMCAO mice model. All experiments and data analyses were performed in a blind and randomized manner.
+ Open protocol
+ Expand
2

Psoriasis-like Dermatitis Model in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
All mice used in this study were purchased from GemPharmatech (Nanjing, Jiangsu, China) including C57BL/6JGpt mice (wild type, WT), B6/JGptGsdmeem8Cd566/Gpt (Gsdme−/− mice), Krt14Cre/+-Gsdmefl/fl (keratinocyte-specific Gsdme cKO mice) and their littermate controls (Krt14 + /+-Gsdmefl/fl). All mice in experiments were between 6-8 weeks of age and weighted 15-25 g. All mice in our experiment were male mice. All mice were randomly allocated to different groups. All mice were applied with imiquimod cream (Sichuan MingXin Pharmaceutical Co. China) on dorsal skin to establish a psoriasis-like dermatitis model. All mice were sacrificed after IMQ applied for 5 consecutive days, and their tissues were collected. No mice were excluded from the analysis. The severity of skin lesions in mice was evaluated by PASI scores, as detailed in our previous study [9 (link)]. Two investigators conducted a blind assessment of the severity of skin lesions in mice.
+ Open protocol
+ Expand
3

Evaluating CAG Therapy in Murine Tumor Models

Check if the same lab product or an alternative is used in the 5 most similar protocols
Six-eight-week-old female C57BL/6JGpt mice, BALB/c mice and BALB/c nude mice were purchased from GemPharmatech (Nanjing, China). MC38 or CT26 cancer cells (1×106) were inoculated subcutaneously into each mouse. When the tumor grows to 100 mm3, the mice were randomly divided into phosphate buffered saline (PBS) group (ig, once a day) and CAG group (ig, 50 mg/kg, once a day). Tumor volumes were determined by caliper measurement using the formula V=length×width2/2. When the tumor volume of PBS group mice reached 1000 mm3, the tumor of mice was taken out, photographed and weighed.
+ Open protocol
+ Expand
4

CRISPR/Cas9 Knockout of Sting1 in Endometritis Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Female and male C57BL/6JGpt mice (5 weeks of age) were purchased from Gempharmatech Co., Ltd. All mice were housed in a specific-pathogen-free environment (humidity, 50 ± 5%; temperature, 20–22 ℃). Endometritis mouse models (10–12 weeks of age; weight, 18–22 g) were induced via LPS intrauterine infusion (1 mg/kg) as described in a previous study.17 (link),18 (link) The CRISPR/cas9 knockout target site in Sting1 was designed using the CRISPR Design website of the Massachusetts Institute of Technology (http://crispor.tefor.net/). The target genes were verified by PCR to confirm the accuracy of gene sequences near the target sites. Primers included the following: PCR① T036783-F1, ACCTGATGGGAGGTATCTACCGG; T036783-R1, CCAGCAACTAGCATCAGAACCTCC; PCR② T036783-F2, GGTGCCTGACAACCTGAGTGTAG; T036783-R2, CCTCAATGCTCTCATAGCCTTCAC.
+ Open protocol
+ Expand
5

Pericyte-Specific Tcaf2 Knockout in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Male BALB/c nude mice (6–8 weeks, weight 20–22 g), male C57BL/6JGpt mice (6–8 weeks, weight 24–26 g), male NOD/SCID mice (6–8 weeks, weight 24–26 g), Cspg4‐CreERT2 mice (B6/JGpt‐Cspg4em1Cin(CreERT2‐P2A)/Gpt; T006187) were obtained from GemPharmatech Co., Ltd. (Nanjing, China). Adeno‐Associated virus (AAV) was administered as previously described.[56] Briefly, 5 × 1010 AAV particles were dissolved in 200 µL PBS. 6‐week old Cspg4‐CreERT2 mice were intravenously (i.v.) injected with AAV‐CTR or AAV‐TCAF2 (Genechem, Shanghai, China) to construct pericyte‐Tcaf2 conditional knockout mice. All the mice were maintained in a specific pathogen‐free (SPF) facility. All animal experiments were approved by the Experimental Animal Ethics Committee of Jinan University (Approval number: 00287194) and complied with ARRIVE guidelines, which were carried out in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH Publication No. 8023, revised 1978).
+ Open protocol
+ Expand
6

Diabetes Induction in Mouse Models

Check if the same lab product or an alternative is used in the 5 most similar protocols
Twelve-week-old male db/db mice (BKS-Leprem2Cd479/Gpt, GemPharmatech, Nanjing, China) were used as a T2DM mouse model. Male C57BL/6JGpt mice (GemPharmatech) and nuclear factor erythroid 2-related factor 2 knockout (Nrf2-KO) mice (kindly provided by Prof. Xuebo Pan at Wenzhou Medical University) aged 8–12 weeks were used to establish T1DM model by streptozotocin (STZ, Sigma, St. Louis, MO, USA) injection (50 mg/kg body weight, one dose a day for 5 days). Those mice with a fasting blood glucose higher than 13.8 mM at the 7th day after the last STZ injection were considered as T1DM mice. Mice were maintained at 22 ± 2 °C with a 12 h light/dark cycle. All animal experimental procedures were carried out in accordance with the policies of Institutional Animal Care and the Use Committee of Wenzhou Medical University.
+ Open protocol
+ Expand
7

Murine C57BL/6J Model for Experiments

Check if the same lab product or an alternative is used in the 5 most similar protocols
A total of 50 male C57BL/6JGpt mice (10 weeks, 22–25 g) were purchased from GemPharmatech Co., Ltd., (cat. no. N000013) as the experimental subjects. All mice were adaptively reared under the specific pathogen-free (SPF) conditions of the animal facility (temperature, 23±2°C; relative humidity, 45~70%; 12-h light/dark cycles) for 1 week. Mice were given free access to sufficient food and water.
All animal experiments were approved by the Ethic Committee of Experimental Animals of Changzhi Medical College (approval nos. M20200109 and R20200115; Changzhi, China).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!