Total RNA was extracted using TRIzol reagent (Invitrogen, USA). For miR223-3p analysis, 2 μg RNA was reverse transcribed to cDNA using the TaqMan MicroRNA reverse transcription kit (Applied Biosystems, Lithuania) and primers targeting miR-223-3p and U6 small nuclear RNA (snRNA; TaqMan MicroRNA assay, Applied Biosystems). MiR223-3p expression levels were measured by RT-PCR using TaqMan Universal Master Mix II (Applied Biosystems, CA, USA) and probes targeting miR-223-3p and U6 (TaqMan MicroRNA assay, Applied Biosystems) in a CFX Connect real-time PCR detection system (Bio-Rad, USA). For other miRNA analysis, cDNA was generated from 2 μg total RNA using the reverse transcription kit (RiboBio, China). MiRNA expression levels were measured by qPCR kit (RiboBio, China) targeting miRNA and U6 (RiboBio, China). For mRNA analysis, cDNA was generated from 2 μg total RNA using the reverse transcription kit (Promega, USA). The sequences of all cDNA primers are listed in Table S2 . Transcript levels were measured by RT-PCR using SYBR Master Mix II (Takara, Japan).
Reverse transcription kit
Manufactured by RiboBio
Sourced in China
The Reverse Transcription Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. This process, known as reverse transcription, is a fundamental step in various molecular biology applications, including gene expression analysis, RNA sequencing, and cDNA library construction.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (13 mentions)
Reverse transcription kit, by Takara Bio (3 mentions)
Sybr green pcr kit, by Takara Bio (3 mentions)
Sybr green pcr kit, by RiboBio (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Abi 7500 system, by Thermo Fisher Scientific (2 mentions)
Rt mix, by Vazyme (2 mentions)
Exoquick kit, by Umibio (2 mentions)
Gapdh, by RiboBio (2 mentions)
Cel mir 39, by RiboBio (2 mentions)
Power sybr master mix, by Thermo Fisher Scientific (2 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Taqman universal master mix 2, by Thermo Fisher Scientific (1 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (1 mentions)
Sybr master mix 2, by Takara Bio (1 mentions)
Reverse transcription kit, by Promega (1 mentions)
Lightcycler 480 2 system, by Roche (1 mentions)
Sybr green master mix, by Takara Bio (1 mentions)
Cytoplasmic nuclear rna purification kit, by Norgen Biotek (1 mentions)
22 protocols using reverse transcription kit
1
Quantification of miRNA and mRNA Levels
2
Isolation and Quantification of CircRNA, mRNA, and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s protocol, total RNAs from tissues, plasma and cells were isolated by using TRIzol reagent (Invitrogen, CA, USA). For circRNA and mRNA, cDNA was synthesized by using reverse transcription kit (Takara, Otsu, Japan) and for miRNA, total RNAs were reversed using RiboBio reverse transcription kit (Guangzhou, China). Quantification of mRNA and circular RNA was performed by using a SYBR Green PCR Kit (Takara, Otsu, Japan), and miRNA PCR was performed by using a SYBR Green PCR Kit (RiboBio,Guangzhou, China). All primer sequences were designed and synthesized by Genery (Nanjing, China). CircPSMC3 expression level was detected using the following primer pair: 5′-GTTTAGGGTCCCTGCCCTTTG-3′ (Forward, or F) and 5′-GTGTTGGGCTGGAAGCCATC-3′ (Reverse, or R). The primer pair of PSMC3 is 5′- AGACGCTGCCCACAGAGTATG -3′ (F) and 5′- CTTTTGGAGGTTGGATCCCC-3′ (R). GAPDH was used to normalize the mRNA and circRNA expression levels and U6 was used to normalize the miRNA expression levels before calculation.
3
Molecular Mechanisms of A&P in Melanoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
B16F10 cells were seeded in 6-well plates and incubated for 24 h at 37°C. Cells were treated with A&P (PE:AE = 1:2, the concentration of PE was 0.2 mg/ml) for 24 h. DMSO (0.1%) was used as the drug vehicle. For experimental groups, cells were exposed to A&P alone or in combination with 20 μM 740Y-P (PI3K/Akt pathway activator; MedChemExpress, China) for 24 h. Total RNA were extracted from B16F10 cells by the TRIzol reagent (Invitrogen, Carlsbad, CA, United States) in strict compliance with manufacturer instructions. RNA was reverse-converted into cDNA and subsequently amplified with the aid of a reverse transcription kit (RiboBio, Guangzhou, China) in accordance with the instructions. All primers are as follows: GAPDH (Forward: AATGGATTTGGACGCATTGGT, Reverse: TTTGCACTGGTACGTGTTGAT), PI3K (Forward: CGAGAGTGTCGTCACAGTGTC, Reverse: TGTTCGCTTCCACAAACACAG), Akt (Forward: CCCTGCTCCTAGTCCACCA, Reverse: TGTCTCTGTTTCAGTGGGCTC), Bcl-2 (Forward: GAGCCTGTGAGAGACGTGG, Reverse: CGAGTCTGTGTATAGCAATCCCA) and Bax (Forward: AGACAGGGGCCTTTTTGCTAC, Reverse: AATTCGCCGGAGACACTCG). Quantitative Real-Time PCR (qRT-PCR) was carried out using the Applied Biosystems StepOnePlus Real-Time PCR System (Applied Biosystems, Singapore).
4
Quantitative Analysis of miR-483-5p and TIMP2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with Trizol reagent (Invitrogen, CA, United States), and the cDNA was synthesized using a reverse transcription kit (Ribobio, China or Vazyme, Nanjing, China) according to the manufacturer’s instructions. miRNA-related primers were produced by Ribobio Company. The sequences of β-Actin primers were as follows: forward, 5′-CACGAAACTACCTTCAACTCC-3’; reverse, 5′-CATACTCCTGCTTGCTGATC-3′. The sequences of TIMP2 primers were as follows: forward, 5′-GCTGCGAGTGCAAGATCAC-3′; reverse, 5′-TGGTGCCCGTTGATGTTCTTC-3′. We used quantitative PCR to detect the expression of miR-483-5p (miDETECT A TrackTM, Ribobio, China) and TIMP2 (Vazyme, Nanjing, China). U6 snRNA or β-Actin were used as internal controls. All samples were run in triplicate, and all reactions were repeated three times independently to ensure reproducibility.
5
Quantification of miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For quantification of the various miRNA levels, cDNAs were synthesized using a reverse transcription kit (RiboBio, Guangzhou, China) in accordance with the manufacturer's instructions. Then, the amplification of miRNA was performed with the specific primers using the LightCycler 480 System II (Roche Applied Science) under the standard conditions. The relative miRNA concentration was quantified as the ratio between the expression of miRNA and the endogenous control U6.
6
RNA Extraction and Quantitative PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Trizol reagent (Invitrogen, Carlsbad, USA) was used to extract Total RNA from cells, which was then reverse transcribed into cDNAs using the Reverse Transcription kit (RiboBio, Guangzhou, China). Quantitative real-time PCR (qRT-PCR) was performed to amplify the cDNA template using a SYBR Premix Dimmer Eraser kit (RiboBio, Guangzhou, China) on the ABI 7500 system, and the relative mRNA levels of genes were determined by using the comparative 2−ΔΔCt method. All primer sequences are listed in Table S1 .
7
Comprehensive RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. RNAs in the cytoplasm and nucleus were extracted by the Cytoplasmic & Nuclear RNA Purification Kit (Norgen, Belmont, CA, USA). The RNA was reverse-converted into cDNA in accordance with instructions using the reverse transcription kit (RiboBio, Guangzhou, China). qRT-PCR was performed with SYBR Green master mix (Takara, Japan), and then the relative level of RNA was detected by the Applied Biosystems StepOnePlus Real-Time PCR System (Applied Biosystems, Singapore). The primer sequences are listed in Table 3 .
β-Actin was used as total and cytoplasmic controls, and U6 was used as nuclear control, respectively.
β-Actin was used as total and cytoplasmic controls, and U6 was used as nuclear control, respectively.
8
Plasma miRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Peripheral venous blood was collected from patients into EDTA-containing tubes and centrifuged at 3000 × g for 10 min at 4 ℃, and plasma was stored at −80 ℃. Total RNA was extracted from 200 µl plasma samples by using the miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany) and cDNA was synthesized using a reverse transcription kit (RiboBio, Guangzhou, China) according to the manufacturer’s instructions. After equal volume dilution of cDNA (20 μl of DNase/RNase-Free Deionized water was added to 20 µl of cDNA), the expression levels of miR-30c-1-3p, miR-432-3p, miR-3154, and miR-379-5p were evaluated by quantitative real-time polymerase chain reaction (qRT-PCR) using specific primers (Supplemental Table 3 ) and the miDETECT A TrackTM miRNA qRT-PCR Kit (RiboBio) following the manufacturer’s protocol; reactions were performed on a CFX96 Touch™ Real-Time PCR Detection System (Hercules, CA, USA). Each reaction was performed in triplicate, and the relative expression level of miRNAs were calculated based on cycle threshold (Ct) values through formula 2-∆Ct, which ∆Ct value is the Ct value of miRNAs in each patient of URAAA/RAAA group minus the average Ct value of miRNAs in the control group.
9
Profiling circRNA, mRNA, and miRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using the manufacturer’s protocol, total RNA was isolated from tissues and cells with TRIzol reagent (Invitrogen, USA). Based on a reverse transcription kit (Takara, Japan), cDNA was synthesized for circRNA and mRNA; based on a RiboBio reverse transcription kit (Guangzhou, China), overall RNA was reverse transcribed for miRNA. Using a SYBR Green PCR Kit (Takara, Japan), we quantified mRNA and circular RNA; using a PCR Kit (RiboBio, China), miRNA PCR was carried out. All primer sequences are listed in Table S2 . GAPDH was used to normalize the mRNA and circRNA expression levels, and U6 was used to normalize the miRNA expression levels before calculation.
10
Quantitative Analysis of CDK1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the tissues with Trizol (Invitrogen). RNA was reverse-transcribed to cDNA with Reverse Transcription Kit (Ribo, China). qRT-PCR was performed on the ABI7500 PCR operating system. Sequences of primers are listed as follows: GAPDH Forward: GAACGGGAAGCTCACTGG, Reverse: GCCTGCTTCACCACCTTCT; CDK1 Forward: GGTTCCTAGTACTGCAATTCG, Reverse: TTTGCCAGAAATTCGTTTGG. Relative CDK1 expression was normalized using equation 2–ΔΔCT. GAPDH served as a reference.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!