Pgl4.10 luc2

Luciferase genes (Luc) from pGL4.10[luc2] or pGL4.12[luc2CP] (Promega, Madison, USA) were replaced with the Luc sensor region of the pWPXL: 5×GRE-Luc lentiviral transfer vector (Lee et al., 2016 (link)). The elongation factor 1α (EF1α) promoter was replaced by the 5×GRE sequences of the 5×GRE-Luc2CP lentiviral transfer vectors to serve as a control reporter constitutively expressing luciferase. The lentivirus was produced by co-transfecting the transfer vector, second-generation packaging vector (psPAX2, Addgene plasmid 12260), and an envelope plasmid (pMD2.G, Addgene plasmid 12259) at a ratio of 2:1:1 into HEK-293T cells [American Type Culture Collection (ATCC), Manassas, USA] using the Effectene reagent (Qiagen). Viral supernatants were collected 48 h after transfection, passed through a 0.2-μm filter, and concentrated by centrifugation using PEG-itTM virus precipitation solution (System Biosciences, Palo Alto, USA). Aliquots were stored in phosphate-buffered saline (PBS) in the presence of TransDux^TM MAX Lentivirus Transduction Enhancer (System Biosciences) and stored at −80°C until use. The titers of lentivirus were in the range of 1.50–1.95×10¹² genome copies/ml.

TGF-β signaling and canonical Wnt signaling were quantified using the Cignal SMAD Reporter (luc) Kit (SABiosciences, Madison) and Cignal TCF/LEF Reporter (luc) Kit (SABiosciences) respectively. Noncanonical Wnt signaling was measured using an AP-1 reporter construct that was created by cloning at the KpnI and XhoI sites an oligo containing 7 copies of the AP-1 binding element (TGACTAA) into the luciferase construct pGL4.10(luc2) (Promega, Madison). Further details are provided in the online-only Data Supplement.

All desalted oligonucleotides and aptamers were purchased from Sigma-Aldrich, Milan, Italy (Supplementary Table S1). The HIV-1 LTR region was inserted into the promoterless luciferase reporter vector pGL4.10-Luc2 (Promega Italia, Milan, Italy) to form the pGL4.10-LTR-Luc2 vector, as previously reported (30 (link)). The Renilla plasmid (p4.74, Promega Italia, Milan, Italy) was used as an internal control. The human enhanced green fluorescent protein-nucleolin plasmid (GFP-Nucleolin) was purchased from Addgene (Addgene, Cambridge, MA, USA). The pEGFP empty vector was used as control (Clontech, Takara Bio, Otsu, Japan).

To construct the target 1A и 1B APC promoter-reporter plasmids, we synthesized the DNA fragments by amplifying the 517-bp 1B promoter region (chr5:112042901–112043417; GRCh37/hg19) and the 435-bp 1A promoter region (chr5:112073194–112073721; GRCh37/hg19) using HCT-116 genomic DNA as a template. The primers were 5′- CTCTCTCGAGTCATCTTTCTATCATCAGCGTCTA −3′ (1BXho forward) and 5′- ACCCAAGCTTATAGGGGGCGCCGAGGCC −3′ (1BHind reverse) CTCTCTCGAGGTGCTGCAAAAATCATAGCAATCG −3′ (APCXhoI forward) and 5′- ACCCAAGCTTTGTGCCAAGGAAAGGCCATC −3′ (APCHindIII reverse) correspondingly. To facilitate plasmid construction, two endonuclease sites, XhoI and HindIII were inserted to both ends of the amplicon (underlined sequences). PCR was performed as follows: 200 μM dNTP; 10-x As-buffer (65 мM Tpиc-HCl pH 8,9; 1,6 мM (NH4)2SO4; 0,05% Tween 20, 15мM MgCl2); 2,5 pmole of reverse APCHind primer + forward APCXho primer or 2.5 pmole of forward 1BXho primer + reverse 1BHind primer; 0,25 μg ДHК; 1 U Taq - polymerase (SibEnzyme, Russia). The amplified fragment was digested with XhoI and HindIII, and then cloned into the luciferase expression vector pGL4.10[luc2] (Promega) with T4 ligase. The constructs were all confirmed by DNA sequencing.

A 10-kb fragment of the Fgfr1 promoter region was subcloned into the firefly luciferase reporter vector pGL4.10Luc2 (Promega, Madison, WI) from the BAC clone. A 2.5-kb fragment of the Fgfr2 promoter region and 8-kb fragment of the Fgfr3 promoter region were amplified by PCR using mouse genomic DNA and cloned into pGL4.10Luc2. All truncated constructs were prepared using the restriction enzyme sites or by PCR amplification. C3H10T1/2 cells were transfected with plasmid DNAs (each luciferase reporter vector 0.1 μg; pRL-Tk Renilla 0.1 μg; pSG5 or pSG5-Runx2 0.05 μg) using FuGENE 6 Transfection Reagent (Roche). Luciferase activities were examined by using Dual-Luciferase Reporter Assay System (Promega), and normalized to Renilla luciferase activity.

The proximal human GLS1 promoter (−1138 to +190 relative to the transcription start site, 1329 base pairs total length) was cloned by PCR amplification from the HPRM39644 pEZX-PG02.1 vector (GeneCopoeia, Rockville, MD, USA) using the primers listed in Table S2, and incorporating restriction sites for SacI (forward primer) and EcoRV (reverse primer). The promoter was then subcloned into the luciferase reporter vector pGL4.10-luc2 (Promega, Madison, WI, USA), generating the construct pGL4.10-hGLS1.
Site-directed mutagenesis of three putative E-box sites was performed sequentially using a QuikChange II XL kit (Agilent Technologies, Santa Clara, CA, USA) and primers listed in Table S3. All constructs were confirmed by sequencing.