Log In Sign up
The largest database of trusted experimental protocols

Rabbit anti h3k27me3

Manufactured by Cell Signaling Technology
Visit Supplier
Sourced in United States

Rabbit anti-H3K27me3 is a primary antibody that specifically recognizes the trimethylated form of lysine 27 on histone H3. This antibody can be used to detect the presence and distribution of this epigenetic histone modification, which is associated with transcriptional repression.

Automatically generated - may contain errors

Lab products found in correlation

Rabbit anti ezh2, by Cell Signaling Technology (7 mentions) Rabbit anti h3, by Cell Signaling Technology (3 mentions) Mouse anti β actin, by Merck Group (3 mentions) Rabbit anti cleaved caspase 3, by Cell Signaling Technology (2 mentions) Chicken anti gfp, by Aves Labs (2 mentions) Hoechst dna stain, by Thermo Fisher Scientific (2 mentions) Rabbit anti h4k16ac, by Santa Cruz Biotechnology (2 mentions) Mouse anti mtor, by Developmental Studies Hybridoma Bank (2 mentions) Alexa fluor conjugates of, by Thermo Fisher Scientific (2 mentions) Rabbit anti h3k9me3, by Abcam (2 mentions) Mouse anti hp1, by Developmental Studies Hybridoma Bank (2 mentions) Mouse anti ecr, by Developmental Studies Hybridoma Bank (2 mentions) Rabbit anti h3k4me3, by Cell Signaling Technology (2 mentions) Rabbit anti h3k9me3, by Cell Signaling Technology (2 mentions) Tissue tek oct, by Sakura Finetek (2 mentions) Fluorescein isothiocyanate (fitc), by Jackson ImmunoResearch (2 mentions) Rhodamine red x, by Jackson ImmunoResearch (2 mentions) Vectashield, by Vector Laboratories (2 mentions) Afd555, by Thermo Fisher Scientific (2 mentions) Mouse anti p53, by Santa Cruz Biotechnology (2 mentions)

Spelling variants of this product

H3K27me3 (257 citations) Anti-H3K27me3 (113 citations) Rabbit anti-H3K27me3 antibody (3 citations)

24 protocols using rabbit anti h3k27me3

1

Cranial Mesenchyme Protein Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
E13.5 cranial mesenchyme was enriched and collected by manual dissection as described above. Protein was isolated using RIPA buffer. Proteins were separated by SDS-PAGE using Mini-PROTEAN TGC gels (BioRad #456–1084). Western Blots were performed with the following primary antibodies: rabbit anti-H3K27me3 (1:1000, Cell Signaling 9733) and rabbit anti-EZH2 (1:500, Cell Signaling #5246). Species-specific HRP-conjugated secondary antibodies were used at 1:10,000. Immunoblots were probed with anti-β-TUBULIN (1:400, Santa Cruz 9104) as a loading control. Protein was detected using an Amersham ECL Western Blotting Analysis System (GE Healthcare RPN2109), and imaged using an Odyssey FC Imaging System (Li-Cor). Relative protein levels were quantified using Image J/ Fiji.
Ferguson J., Devarajan M, & Atit R.P. (2018). Stage-specific roles of Ezh2 and Retinoic acid signaling ensure calvarial bone lineage commitment.. Developmental biology, 443(2), 173-187.
+ Open protocol
+ Expand
2

CHD2 and H3K27me3 CUT&Tag in Stem Cells

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
CUT&Tag was performed on WT hESCs (day 0), hMGEs (day 15), and hcINs (day 35) for CHD2 and H3K27me3. The protocols.io V.2. protocol37 (link) was followed, using a minimum of 200,000 cells per sample. The protein A-Tn5 fusion protein (pA-Tn5) was provided by the laboratory of Steve Henikoff and the antibodies used were Rat anti-CHD2 (Sigma MABE873) and Rabbit anti-H3K27me3 (Cell Signaling Technology #9733). Secondary antibodies used were Rabbit anti-Rat IgG (abcam ab6703) and Guinea Pig anti-Rat IgG (Antibodies-Online ABIN101961). Samples with unique dual-end indexes were pooled in equimolar concentrations and were sequenced by the Washington University Genome Technology Access Center (GTAC) @MGI on the NovaSeq-6000 sequencer with the S4 flow cell as 2 × 150 bp paired-end reads at a depth of at least 10 million (M) reads per sample. Raw reads from CUT&Tag samples were processed by AIAP (v1.1) using human genome hg38 as a reference to perform read quality control, alignment, quantification, and peak calling38 (link). Peaks from replicates were intersected using bedtools intersect peak with options -f 0.25 -F 0.25 -e. Peaks identified as intersecting in 2 or more out of 4 total replicates were defined as reproducible peaks.
Lewis E.M., Chapman G., Kaushik K., Determan J., Antony I., Meganathan K., Narasimhan M., Gontarz P., Zhang B, & Kroll K.L. (2022). Regulation of human cortical interneuron development by the chromatin remodeling protein CHD2. Scientific Reports, 12, 15636.
+ Open protocol
+ Expand
3

Western Blot Analysis of Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total protein extracts and pulled-down samples were boiled in sample buffer and loaded onto Mini-PROTEAN TGX precast gels (Biorad). Proteins were transferred to a PVDF membrane (Trans-Blot Turbo Transfer System, Biorad), and probed for the following antibodies: Mouse anti-FLAG (1/1000, Sigma F1804), Mouse anti-total H3 (1/1000, Cell Signaling 3638), Rabbit anti-Histone H3.3 (1/1000, Clone RM190 Rev mab biosciences 31-1058-00), Rabbit anti-H3K27me3 (1/1000, Cell signaling 9733), Mouse anti-H4 (1/1000, Active motif 61521), Rabbit anti-H3.3K27M (1/1000, Merck ABE419), Rabbit anti-H3K27me3 (1/1000, Merck 07–449), Rabbit anti-EZH2 (1/1000, Cell signaling 5246), Mouse Anti-GAPDH (1/5000, Fitzgerald 10R-G109A), Goat anti-MCM2 (1/1000, Bethyl A300-122A), Rabbit anti-MCM7 (1/1000, Bethyl A302-584A), and Rabbit anti-MCM4 (1/1000, Bethyl A300-193A). HRP labelled Goat anti-Mouse or Rabbit, or Donkey anti-Goat secondary antibodies were used to visualize protein expression using chemiluminescence substrate (SuperSignal West Dura Extended Duration Substrate, Thermo 34076) on a ChemiDoc system (Biorad). Densitometry analysis was performed with the ImageStudio Lite v5.2.5 (Licor).
Bočkaj I., Martini T.E., de Camargo Magalhães E.S., Bakker P.L., Meeuwsen-de Boer T.G., Armandari I., Meuleman S.L., Mondria M.T., Stok C., Kok Y.P., Bakker B., Wardenaar R., Seiler J., Broekhuis M.J., van den Bos H., Spierings D.C., Ringnalda F.C., Clevers H., Schüller U., van Vugt M.A., Foijer F, & Bruggeman S.W. (2021). The H3.3K27M oncohistone affects replication stress outcome and provokes genomic instability in pediatric glioma. PLoS Genetics, 17(11), e1009868.
+ Open protocol
+ Expand
4

Histological and Immunohistochemical Analysis of Testes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Testes were fixed in Bouin’s overnight, embedded in paraffin, and sectioned at 4 μm. Following standard protocols, sections were deparaffinized, rehydrated, and then stained with Hematoxylin and Eosin for histology. Immunostaining of testis cryosections was prepared as previously described (Kim et al., 2012 (link)). The primary antibodies used in this study were as follows: rabbit anti-H3K27me2 (1:6000; Cell Signaling), rabbit anti-H3K27me3 (1:1000; Cell Signaling), mouse anti-MVH (1:1000, Abcam), mouse anti-γH2AX (1:1000; Millipore and Cell Signaling), mouse anti-PLZF (1:500, Calbiochem), and rabbit anti-cleaved Caspase-3 (1:200, Cell Signaling). Secondary antibodies conjugated with either Alexa Fluor 488 or 594 (Molecular Probes) were used at a dilution of 1:500. In situ hybridization was performed as described previously (Chandler et al., 2007 (link)) with antisense probes to Ezh1. The probe was generated by PCR sub-cloning a mouse Ezh1 cDNA fragment into pGEM T-Easy using the following gene specific primers: (F) CTGATCAGCGATGCTGTGTT; (R) GCCCACAACCTGTGTTTTCT.
Mu W., Starmer J., Shibata Y., Yee D, & Magnuson T. (2017). EZH1 in Germ Cells Safeguards the Function of PRC2 during Spermatogenesis. Developmental biology, 424(2), 198-207.
+ Open protocol
+ Expand
5

Immunofluorescence Microscopy Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary antibodies and dilutions used were as follows: Rabbit anti-MOF (gift from Kuroda lab) at 1:100–1:200, Rabbit anti-H4K16ac (#8662 from Santa Cruz Biotechnology) at 1:100, Mouse anti-HP1 (C1A9 from the Developmental Studies Hybridoma Bank) at 1:200, Mouse anti-EcR (DDA2.7 from the Developmental Studies Hybridoma Bank) at 1:100, Mouse anti-Mtor (#12F10 from the Developmental Studies Hybridoma Bank) at 1:30, Chicken anti-GFP (#1020 from Aves Labs Inc.) at 1:500, Rabbit anti-H3K27me3 (#9733 from Cell Signaling) at 1:100, Rabbit anti-H3K9me3 (ab8898 from Abcam) at 1:100 and Hoechst DNA stain (H3570; ThermoFisher) at 1:1,000. Fluorescently conjugated secondary antibodies were as follows: ThermoFisher Alexa Fluor conjugates of goat anti-mouse, anti-rabbit, 488 and 568 at 1:300.
Aleman J.R., Kuhn T.M., Pascual-Garcia P., Gospocic J., Lan Y., Bonasio R., Little S.C, & Capelson M. (2021). Correct dosage of X chromosome transcription is controlled by a nuclear pore component. Cell reports, 35(11), 109236.
+ Open protocol
+ Expand
6

Immunostaining and Western Blot Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary antibodies used were rabbit anti-Ezh2 (Cell Signaling Technology), rabbit anti-H3K27me3 (Cell Signaling Technology), rabbit anti-α Tubulin (Abcam), rabbit anti-H3 (Cell Signaling Technology), mouse anti-Reelin (Millipore), rabbit anti-GRASP65 (Abcam), rabbit anti-Cux1 (Santa Cruze), rabbit normal IgG (Applygen). Second antibodies included anti-rabbit IgG IRDye 680 and anti-mouse IgG IRDye 800 (LICOR Bioscience) for western blot and Alexa 488 anti-rabbit IgG, alexa 555 anti-rabbit IgG (Invitrogen) for immunostaining.
Zhao L., Li J., Ma Y., Wang J., Pan W., Gao K., Zhang Z., Lu T., Ruan Y., Yue W., Zhao S., Wang L, & Zhang D. (2015). Ezh2 is involved in radial neuronal migration through regulating Reelin expression in cerebral cortex. Scientific Reports, 5, 15484.
+ Open protocol
+ Expand
7

Macrophage Epigenetic Regulation Study

Check if the same lab product or an alternative is used in the 5 most similar protocols
BMDMs were treated as indicated. Whole-cell lysates were prepared in RIPA buffer and subjected to western blotting. The antibodies used were rabbit anti-HP1-α, rabbit anti-H3K4me3, rabbit anti-H3K9me3, rabbit anti-H3K27me3, rabbit anti-H3K27Ac, rabbit anti-H, rabbit anti-NF-B, rabbit anti-ERK, rabbit anti-MAPK, rabbit anti-p-SAPK-JNK, rabbit anti-NF-κB, rabbit anti-ERK, rabbit anti-MAPK, rabbit anti-SAPK-JNK, mouse anti-actin, HRP-conjugated donkey anti-rabbit IgG and HRP-conjugated sheep anti-mouse IgG (all purchased from Cell Signaling Technology, Danvers, MA, USA). The signals were detected by chemiluminescence. The protein bands intensities were quantitated using ImageJ Gel Analysis program. The modified proteins were normalized to their loading controls (total forms) and relatively normalized to those of the unstimulated cells.
Boonmee A., Benjaskulluecha S., Kueanjinda P., Wongprom B., Pattarakankul T, & Palaga T. (2021). The chemotherapeutic drug carboplatin affects macrophage responses to LPS and LPS tolerance via epigenetic modifications. Scientific Reports, 11, 21574.
+ Open protocol
+ Expand
8

Immunofluorescence Microscopy Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Primary antibodies and dilutions used were as follows: Rabbit anti-MOF (gift from Kuroda lab) at 1:100–1:200, Rabbit anti-H4K16ac (#8662 from Santa Cruz Biotechnology) at 1:100, Mouse anti-HP1 (C1A9 from the Developmental Studies Hybridoma Bank) at 1:200, Mouse anti-EcR (DDA2.7 from the Developmental Studies Hybridoma Bank) at 1:100, Mouse anti-Mtor (#12F10 from the Developmental Studies Hybridoma Bank) at 1:30, Chicken anti-GFP (#1020 from Aves Labs Inc.) at 1:500, Rabbit anti-H3K27me3 (#9733 from Cell Signaling) at 1:100, Rabbit anti-H3K9me3 (ab8898 from Abcam) at 1:100 and Hoechst DNA stain (H3570; ThermoFisher) at 1:1,000. Fluorescently conjugated secondary antibodies were as follows: ThermoFisher Alexa Fluor conjugates of goat anti-mouse, anti-rabbit, 488 and 568 at 1:300.
Aleman J.R., Kuhn T.M., Pascual-Garcia P., Gospocic J., Lan Y., Bonasio R., Little S.C, & Capelson M. (2021). Correct dosage of X chromosome transcription is controlled by a nuclear pore component. Cell reports, 35(11), 109236.
+ Open protocol
+ Expand
9

Western Blot Protein Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Whole-cell lysates, nuclear extracts, or acid extracts were prepared from cells pelleted after washing with phosphate-buffered saline (PBS). Samples were diluted in NuPAGE LDS Sample Buffer (Novex) and 10% 2-mercaptoethanol. Protein samples were run on NuPAGE Bis-Tris mini gels (Novex), and membrane transfer was performed in 1× MES NuPAGE buffer (Novex). The following antibodies were used for probing of membranes: Primary antibodies–mouse anti-c-Myc (Santa Cruz Biotechnology, #sc-40), mouse anti-n-Myc (Santa Cruz Biotechnology, #sc-53993), mouse anti-H3 (Upstate/Millipore Sigma, #05-499), rabbit anti-H3.3 (Millipore Sigma, #09-838), rabbit anti-H4 (Millipore Sigma, #04-858), rabbit anti-H3K27M (Millipore Sigma, #ABE419), mouse anti-Cas9 (Cell Signaling, #14697), rabbit anti-H3K27me3 (Cell Signaling, #C36B11), rabbit anti-H3.3S31p (AbCam #ab92628), rabbit anti-H3K27ac (Abcam, #ab4729), rabbit anti-K36me3 (Abcam, #ab9050), rabbit anti-NOTCH (Abcam, #ab52627), rabbit anti-ASCL1(MASH1) (Abcam, #ab74065), mouse anti-beta actin (Sigma, #A1978), rabbit anti-RBPJ (Millipore-Sigma #ABE384); secondary antibodies—IRDye 680RD goat anti-mouse (1:10,000; LiCor) and IRDye800CW goat anti-rabbit (1:10,000; LiCor). Blots were imaged, data were captured on a Licor Odyssey CLx, and quantification was performed with the Licor ImageStudio software.
Chen K.Y., Bush K., Klein R.H., Cervantes V., Lewis N., Naqvi A., Carcaboso A.M., Lechpammer M, & Knoepfler P.S. (2020). Reciprocal H3.3 gene editing identifies K27M and G34R mechanisms in pediatric glioma including NOTCH signaling. Communications Biology, 3, 363.
+ Open protocol
+ Expand
10

Western Blot Analysis of Epigenetic and RNA Regulatory Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Proteins were separated by SDS/PAGE gels and transferred onto nitrocellulose membranes (Millipore). The membranes were blocked in TBST (10 mM Tris-HCl pH 7.4, 150 mM NaCl, and 0.1% Tween-20) containing 5% non-fat milk at room temperature for 60 min. Primary antibodies were diluted in TBST containing 5% BSA, and used at the following concentrations: rabbit anti-EZH2 (1:1000, 5246, Cell Signaling Technology), rabbit anti-H3K27me3 (1:1000, 9733, Cell Signaling Technology), rabbit anti-Dicer1 (1:1000, 5362, Cell Signaling Technology), rabbit anti-LOXL4 (1:1000, 88186, Abcam), mouse anti-β-actin (1:5000, Sigma). The membranes were incubated with primary antibodies at 4 °C overnight, then washed three times with TBST and incubated with HRP-conjugated anti-mouse IgG (1:10,000, 7076, Cell Signaling Technology) or anti-rabbit IgG (1:10,000, 7074, Cell Signaling Technology) diluted in TBST containing 1% non-fat milk at room temperature for 60 min. After final washing with TBST, the membranes were developed by using ECL and visualized using Tanon 5500.
Yin H., Wang Y., Wu Y., Zhang X., Zhang X., Liu J., Wang T., Fan J., Sun J., Yang A, & Zhang R. (2020). EZH2-mediated Epigenetic Silencing of miR-29/miR-30 targets LOXL4 and contributes to Tumorigenesis, Metastasis, and Immune Microenvironment Remodeling in Breast Cancer. Theranostics, 10(19), 8494-8512.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!