Taqman gene expression assay

Total RNA was extracted in a guanidine thiocyanate buffer and isolated with Wizard^® SV 96 Binding Plates (Promega; A2271). cDNA was subsequently reverse-transcribed using Maxima First Strand cDNA Synthesis Kit for reverse transcription-quantitative polymerase chain reaction (RT-qPCR), with dsDNase (ThermoFisher; K1672). qPCR was performed using TaqMan Gene Expression Master Mix (Applied Biosystems; 4369016) and TaqMan Gene Expression Assays (Supplementary Table S4) using a LightCycler 480 II (Roche). The relative expression of each gene was calculated with the ΔΔCq method using GAPDH or ACTB as the housekeeping gene and normalized to a non-targeting control (NTC).

Total RNA was isolated using a TRI reagent. A total of 500 ng of total RNA was reverse-transcribed using a random hexamer primer and the MMLV Reverse Transcriptase Kit or 1000 ng of total RNA was reverse-transcribed using an EvoScript Universal cDNA. Quantitative PCR was carried out using the SYBR Green reagent and a LightCycler 480 apparatus (Roche, Meylan, France) or using TaqMan Gene Expression Assays and a LightCycler 1536 Instrument (Roche, Basel, Switzerland). Subsequently, 384-well plates were pipetted using Liquid Handling Robot (EpMotion 5070, Eppendorf, Hamburg, Germany), and 1536-well plates were pipetted using Echo Liquid Handler (Labcyte, Dublin, Ireland). The amplification specificity of the SYBR Green reagent was evaluated by determining the product melting curve. Target genes were determined using primers, as shown in Table 2. The relative mRNA expression was normalized to the expression of ribosomal protein lateral stalk subunit P0 (RPLP0) as a housekeeping gene. The expressions of the target genes were calculated by the ΔΔCT method [55 (link)] as fold change in the treatment groups relative to the control. All treatments were measured four times.

Total RNA was isolated using QiaZOL lysis (Qiagen, Valencia, CA, USA), and further purified using Qiagen RNeasy columns. cDNA was prepared from RNA by ImProm-II Reverse Transcription System (Promega, Madison, WI, USA). Quantitative PCR for mouse LincRNA-p21 (FAM probe TGGCCAAACACTGGTG, forward primer GAAGCTTCCTTGGTGTAGATCAAAA, reverse primer CCACACCAGGTAGAAACTACGAAA) and human LincRNA-p21 (FAM probe ATGCGGCCTTGCAGG, forward primer CCCGGGCTTGTCTTTTGTT, reverse primer GAGTGGGTGGCTCACTCTTCTG) was performed using Custom TaqMan Gene Expression Assays (Life Technolgies).^{31 (link)} Additional mouse TaqMAN RT-PCR assays include p53 Mm441964_g1, Gapdh Mm99999915_g1, β-Actin Mm00607939_s1, Noxa Mm00451763_m1, Atf2 Mm00833804_g1, Survivin Mm00599749_m1, Mcl1 Mm00725832_s1, Bax Mm00432051_m1. Puma Mm00519268_m1, Cdkn1a Mm00432448_m1 and Stat3 Mm01219775_m1. Additional human TaqMAN RT-PCR assays include GAPDH Hs33929097_g1, β-Actin Hs99999903_m1, NOXA Hs00560402_m1, ATF2 Hs01095345_m1, CDKN1A Hs00355782_m1 and STAT3 Hs01047580_m1 (Life Technologies). TaqMan Gene Expression Assays were used in combination with FastStart Universal Probe Master Mix (Roche). Data were analyzed using the comparative ΔΔC_T method.

Total RNA was isolated from 200 μL of plasma and FFPE samples using the High Pure RNA Isolation Kit and High Pure RNA Paraffin Kit according to the manufacturer's instructions. Single-stranded cDNA was synthesized by RT using ReverTra Ace, and single-stranded cDNA for microRNA analysis was also synthesized by RT using the miScript Reverse Transcription Kit according to the manufacturer's instructions. Real-time PCR was performed using the LightCycler 480 ΙΙ System (Version 1.5; Roche Diagnostics GmbH, Mannheim, Germany) with TaqMan gene expression assays and the THUNDERBIRD qPCR Mix or miScript SYBR Green PCR Kit according to the manufacturer's instructions. Comparative real-time RT-PCR assays were performed for each sample in triplicate. The comparative quantification cycle threshold (C_q) method was used to determine the relative expression levels of the target genes. C_q values were calculated with the second derivative maximum method. GAPDH and RNU6B (U6) were analyzed as a reference gene for mRNA and microRNA, respectively [25 (link), 26 (link)]. The cycle number difference (ΔC_q = reference genes − target genes) was calculated in each replicate. Relative target gene expression values were calculated using the mean of ΔC_q from the three replicates, that is, μ (ΔC_q) = Σ (ΔC_q)/3, and expressed as [27 (link)].

qRT-PCR was performed using TaqMan gene expression assays and the LightCycler^®480 II System (Roche, Basel, Switzerland). The amplified DNA was analyzed by the comparative Ct method using β-actin as a reference gene. The primer and probe sets for ACTB (assay ID: Hs99999903_m1), BECN1 (Hs00186838_m1), BIRC5 (Hs00153353_m1), CCL2 (Hs00234140_m1), MAP1LC3 (Hs00797944_s1), SOX2 (Hs01053049_s1), NANOG (Hs04260366_g1), POU5F1 (Hs04260367_gH), and HIF1A (Hs00153153_m1) were selected from the TaqMan gene expression assays (Life Technologies, USA). The qRT-PCR was performed under the following amplification conditions: total volume of 20 μl, initial incubation at 50°C/2 min followed by denaturation at 95°C/10 min, then 45 cycles at 95°C/ 15 sec and at 60°C/1 min.