The cecum mid-segments were rinsed in cold sterile PBS and the washed tissue was shock frozen in RNAlater (Qiagen) using liquid nitrogen and stored at -80°C until RNA extraction. Total RNA was extracted using the RNeasy Mini Kit (Qiagen). The RNA concentration of each sample was adjusted to 0.125 μg/μl and samples were reverse-transcribed using the RT2 HT First Strand cDNA Kit (Qiagen). Custom RT2 Profiler PCR Arrays and Primer Assays (Qiagen) were run with Universal FastStart SYBR Green Master (ROX; Roche) on the StepOne Plus real-time PCR system (Applied Biosystems) using the following cycling conditions: 1) Initial denaturation: 95°C for 14 min; 2) Denaturation: 94°C for 15 sec; 3) Annealing: 61°C for 30 sec; 4) Extension: 72°C for 20 sec. Cycles 2-4 were repeated 40 times. Relative transcript levels were normalized to actin-b. The upper limit of Cq was fixed to 38 cycles. All procedures were performed according to the manufacturer’s instructions.
Rt2 ht first strand cdna kit
Manufactured by Qiagen
Sourced in Switzerland, United States
The RT2 HT First Strand cDNA Kit is a laboratory equipment product designed for the reverse transcription of RNA to cDNA. It is a tool used in molecular biology and gene expression analysis workflows.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (8 mentions)
Rnalater, by Qiagen (3 mentions)
Faststart universal sybr green master reagent, by Roche (3 mentions)
Quantstudio 7 flex fstepone plus cycler, by Roche (3 mentions)
Custom rt2 profiler pcr arrays and primer assays, by Qiagen (2 mentions)
Faststart universal sybr green master rox, by Roche (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Custom rt2 profiler pcr array, by Qiagen (2 mentions)
Rnase free dnase digest, by Qiagen (2 mentions)
Rt2 sybr green rox fast, by Qiagen (2 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Rnalater solution, by Thermo Fisher Scientific (2 mentions)
Rotor gene 6000 series software, by Qiagen (1 mentions)
Rotor gene 3000, by Qiagen (1 mentions)
Faststart universal sybr green master, by Roche (1 mentions)
Qiashredder kit, by Qiagen (1 mentions)
Faststart universal sybr green master rox reagent, by Roche (1 mentions)
Steponeplus cycler, by Thermo Fisher Scientific (1 mentions)
Rnalater, by Merck Group (1 mentions)
Rneasy micro kit, by Qiagen (1 mentions)
10 protocols using rt2 ht first strand cdna kit
1
Cecum Transcriptome Analysis via Real-Time PCR
2
Cecum Transcriptome Analysis via Real-Time PCR
3
Quantification of IL-15 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lungs and spleens from naïve mice were isolated and single cell suspensions were prepared. Hematopoietic and non-hematopoietic cell populations were sorted based on CD45 expression. RNA isolation was performed using Trizol LS reagnet (Life Technologies) as described before. 100 ng RNA was reverse-transcribed using the RT2 HT First Strand cDNA kit (QiaGEN, Hombrechtikon, Switzerland) according to the manufacturer's instructions. Real-time PCR was performed using a Rotorgene 3000 instrument (Corbett Research, Eight Miles Plains, Australia) to assess SYBR green incorporation (FastStart Universal SYBR Green Master, Roche Diagnostics, Switzerland). The following primer pairs were used for qPCR: IL-15: 5′-CATCCATCTCGTGCTACTTGTG-3′ and 5′-GCCTCTGTTTTAGGGAGACCT-3′ [75 (link)], β-actin: 5'-CCCTGAAGTACCCCATTGAAC-3' and 5'-CTTTTCACGGTTGGCCTTAG-3'. Data were analysed with Rotor-Gene 6000 Series Software (Qiagen, Hombrechtikon, Switzerland). Expression of the housekeeping gene β-acting was used as an internal control for normalisation. Relative expression levels were calculated according to the 2-ΔΔCT method [76 (link), 77 (link)].
4
RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed with PBS, displaced from the flask using Trypsin EDTA and spun down at 1000xg for 5min. The supernatant was resuspended in 600 μl RLT buffer. Total RNA extraction was done using the RNeasy mini kit (Qiagen) with RNase-free DNase digest (Qiagen). For reverse-transcription of 1 μg mRNA aliquots, the RT2 HT First Strand cDNA Kit (Qiagen) was used. Custom RT2 Profiler PCR Arrays (Qiagen) were run with RT2 SYBR Green ROX FAST (QIAGEN) on an Applied Biosystems 7900 HT Fast Real-Time PCR System to amplify the resulting cDNA. Relative mRNA levels (2−ΔCq) were determined by comparing the PCR quantification cycle (Cq, determined with the Software SDS 2.2.1) with the reference gene ACTB. The differences in their Cq cycles were calculated (ΔCq). In all experiments, the upper limit of Cq was fixed to 35 cycles.
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For gene expression analysis, tissue was snap frozen in RNAlater (Sigma-Aldrich). RNA isolation was performed with the Qiagen RNeasy Mini Kit according to the manufacturer's instructions, including DNase digestion. For sorted intestinal DCs, RNA isolation was performed with the Qiagen RNeasy Micro Kit after cell lysis with the QIAShredder Kit (Qiagen) according to the manufacturer`s instructions. One microgram of isolated RNA was subsequently transcribed into cDNA using the Qiagen RT2 HT First Strand cDNA Kit, and stored at −20 °C until analysis. qPCR was performed with FastStart Universal SYBR Green Master (Rox) reagents (Roche) on a StepOne Plus Cycler (Thermo Fischer). mRNA levels were normalized to Actb and calculated with the 2−ΔCT-method. Primers for the indicated genes were purchased from Qiagen (RT2 qPCR Primer Assay).
6
Gene Expression Analysis of S. Typhimurium Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The excised cLN was placed in 600 µl RNAlater (Qiagen) and shock frozen at −80°C. Total RNA extraction was done using the RNeasy mini kit (Qiagen) with RNase-free DNase digest (Qiagen). For reverse-transcription of 1 µg mRNA aliquots, the RT2 HT First Strand cDNA Kit (Qiagen) was used. Custom RT2 Profiler PCR Arrays (Qiagen) were run with RT2 SYBR Green ROX FAST (QIAGEN) on an Applied Biosystems 7900HT Fast Real-Time PCR System to amplify the resulting cDNA. Relative mRNA levels (2-ΔCq) were determined by comparing the PCR quantification cycle (Cq, determined with the Software SDS 2.2.1) for genes related to inflammation and defense against S. Typhimurium infection (the selection is based on [61] (link)) with the reference gene Actb. The differences in their Cq cycles were calculated (ΔCq). In all experiments, the upper limit of Cq was fixed to 35 cycles. Then, the fold actin was calculated and plotted. Each sample was controlled for mouse genomic DNA contamination. All DNA-positive data were excluded from further analysis.
7
Cecal tissue RNA extraction and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cecal tissue sections were snap-frozen in RNAlater solution (Thermo Fisher Scientific) after extensive washing of the content in PBS and stored in -80°C until further analysis. Total RNA was extracted using RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions and converted to cDNAs employing RT2 HT First Strand cDNA Kit (Qiagen). qPCR was performed with FastStart Universal SYBR Green Master reagents (Roche) and Ct values were recorded by QuantStudio 7 Flex FStepOne Plus Cycler. Primers were designed using the NCBI primer-designing tool (see Table 1
8
Quantification of Intestinal Stem Cell Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cecal content was removed from cecal tissue samples, these were flash frozen in RNAlater (Invitrogen) and stored at −80 °C until further processed. RNA was isolated using RNeasy Mini Kit (Qiagen) and reverse transcribed employing RT2 HT First Strand cDNA Kit (Qiagen). qPCR was performed with FastStart Universal SYBR Green Master reagents (Roche) on a QuantStudio 7 Flex FStepOne Plus Cycler. Primers were purchased as validated primer assays from Qiagen, except for those primer pairs detecting Caspase-3, Caspase-8, Lgr5, and Acl2 transcripts (listed in Table 1 ).
Custom-designed primers used in this study.
| Gene | Forward primer sequence | Reverse primer sequence |
|---|---|---|
| Mouse Caspase-3 | TGACTGGAAAGCCGAAACTC | AGCCTCCACCGGTATCTTCT |
| Mouse Caspase-8 | ATGGCTACGGTGAAGAACTGCG | TAGTTCACGCCAGTCAGGATGC |
| Mouse Lgr5 | ACCCGCCAGTCTCCTACATC | GCATCTAGGCGCAGGGATTG |
| Mouse Ascl2 | GAGAGCTAAGCCCGATGGAG | CCAGGGATGCAGCTTAGGG |
9
Cecal RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cecal tissue sections were snap-frozen in RNAlater solution (Thermo Fisher Scientific) after extensive washing of the content in PBS and stored at −80°C until downstream analysis. Total RNA was extracted using RNeasy Mini Kit (Qiagen) and converted to cDNAs employing RT2 HT First Strand cDNA Kit (Qiagen). qPCR was performed with FastStart Universal SYBR Green Master reagents (Roche) and Ct values were recorded by QuantStudio 7 Flex FStepOne Plus Cycler. Primers used either were from Qiagen as pre-validated primer assays for Cxcl9, il1a, Ccl2, Adgre1 (F4/80), or designed using the NCBI primer-designing tool (see Table 2 ). The mRNA expression levels were plotted as relative gene expression (2-ΔΔCt)) and comparisons are specified in the figure caption.
10
Gene Expression Analysis of bEnd.3 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from confluent bEnd.3 cells grown in petri dishes, using RNeasy1 Mini Kit (Qiagen, Hilden, Germany). RNA quality was checked by Experion automated electrophoresis system (Bio-Rad Hercules, CA, USA) and cDNA synthesis was performed by Qiagen RT2 HT First Strand cDNA kit using 2.0mg of RNA. RT2 SYBR Green Mastermix was used to amplify and quantify genes expression on a cycler (Bio-Rad iQ5 model). Specific primers were designed for gene relative expression of CDKN1A (F: 50 TGACAGATTTCTATCACTCCAAG30 ; R: 50 TGACCCACAGCAGAAGAG30 ) and HDAC6 (F: 50 GCAGGAGGCAAGTTGATT30 ; R: 50 AAGAAGGGTGTGGAGTGA30 ). Data were analyzed by DDCT method after normalization to GUSB (F: 50 GGTGAAGGTGACAACAACT30 ; R: 50 CTGAATCCTCGTGCTTATTGA30 ) housekeeping gene expression.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!