Sybr green jumpstart kit

RNA was extracted from cells using TriReagent (Sigma–Aldrich) according to the manufacturer's instructions. First-strand cDNA was synthesized from 1 μg of total RNA using oligo(dT)₁₅ primers and Moloney murine leukaemia virus reverse transcriptase (Promega) according to the manufacturer's instructions. Real-time quantitative PCR was performed using a StepOne Plus real-time thermocycler (Applied Biosystems), SYBR Green JumpStart kit (Sigma–Aldrich) and primers targeting GSK3α, GSK3β, L-type (leucine) amino acid transporter 1 (LAT1), SNAT2 and GAPDH as a control. Sequences of primers used are shown in Supplementary Table S1. PCR conditions were as follows: initial denaturation at 95°C for 2 min followed by 40 cycles of 95°C for 15 s, 55°C for 15 s and extension at 68°C for 30 s. The ratio of GSK3, LAT1 and SNAT2 expression to GAPDH mRNA expression was calculated using a method described previously [25 (link)].

RNAs were isolated by Guanidinium-thiocyanate/phenol/chloroform extraction. 1 μg total RNA was converted to first-stand cDNA using SuperScript II retrotranscription kit (Invitrogen). Quantitative PCR were performed on 1% of the retrotranscribed mixture, using the sybr Green Jump Start Kit (Sigma Aldrich), 150 nM primers, in 96-well plates on a C1000 Thermal Cycler (BioRad). Oligonucleotide primers used in this study:

36b4: GTCACTGTGCCAGCCCAGAA and TCAATGGTGCCCCTGGAGAT

ERα: CCGGCATTCTACAGGCCAAA and CCTTGGCAGATTCCATAGCCA

ERβ: GGCCTCCATGATGATGTCCC and CGAACAGGCTGAGCTCCACA

COL1A1: TTGCTCCCCAGCTGTCTTAT and AGACCACGAGGACCAGAGG

COL5A1: CCGGATGTCGCTTACAGAGT and CTGCCTTTCTTGGCTTTCAC

COL6A1: GGTATTCCAGGATGCAATGG and GGTATTCCAGGATGCAATGG

EGFR: CCCAGTGACTGCTGCCACAA and CAGGTGGCACCAAAGCTGTA

CCND1: CGTGGCCTCTAAGATGAAGGA and TCGGGCCGGATAGAGTTGT

CCND3: TCACTGGCACTGAAGTGGAC and AGCTGGTCTGAGAGGCTTCC

RNA was extracted from cells using TriReagent according to the manufacturer's instructions. First-strand cDNA was synthesised from 1 μg of total RNA using oligo(dT)15 primers and MMLV reverse transcriptase according to the manufacturer's instructions. Real-time quantitative PCR was performed using a StepOne Plus real-time thermocycler (Applied Biosystems), SYBR Green JumpStart kit (Sigma–Aldrich) and primers targeting SNAT2, CDK5, CHOP, ATF3, ATF4, EGR1 and GAPDH (Table 1). PCR conditions were as follows: initial denaturation at 95 °C for 2 min followed by 40 cycles of 95 °C for 15 s, 55 °C for 15 s and extension at 68 °C for 30 s. The ratio of SNAT2, ATF3, ATF4, EGR1 and CHOP expression to GAPDH mRNA expression was calculated using a method described previously [46 ].

Total RNA was obtained from 1 × 10⁷ neutrophils by the guanidine isothiocyanate extraction method using TRIzol^® Reagent (Invitrogen, Carlsbad, CA, USA) (49 (link)) followed by isolation using RNeasy mini kit (Qiagen). The purity was assessed by the 260/280 nm ratio and the quantity measured at 260 nm. The cDNA was synthesized from total RNA (1.0 µg) using the High Capacity kit (Invitrogen). The following primers were used: Atg14 (5′-TGCCGAACAATGGGGACTAC-3′ and 5′-AGGCAGGGTTGTTATGCTCC-3′), Atg5 (5′-CTCAGCTCTGCCTTGGAACA-3′ and 5′- GTGAGCCTCAACTGCATCCT-3′), Beclin (5′-AGCACGCCATGTATAGCAAAGA-3′ and 5′-GGAAGAGGGAAAGGACAGCAT-3′), LC3II (5′-CCAAGCCTTCTTCCTCCTGG-3′ and 5′- TCTCCTGGGAGGCATAGACC-3′), and Rab9 (5′-CCAATGTTGCTGCTGCCTTT-3′ and 5′-GAGTTTGGCTTGGGCTTTCG-3′). Real-time PCR analysis was performed using the SyBR Green JumpStart kit (Sigma Aldrich) in a Rotor Gene 6000 equipment (Corbett Research, Mortlake, Australia). Gene expression was performed by 2^−ΔΔCT using RPL37a gene (5′-CGCTAAGTACACTTGCTCCTTCTG-3′and 5′-GCCACTGTTTTCATGCAGGAAC-3′) as inner control.

Total RNA was obtained from 5 × 10⁶ neutrophils by the guanidine isothiocyanate extraction method using TRIzol® Reagent^{81 (link)} (Invitrogen, Carlsbad, CA, USA) followed by isolation using RNeasy mini kit (Qiagen). cDNA was synthesized from total RNA (0.5 µg) using High Capacity cDNA reverse transcription kit (Thermo Scientific), according to the manufacturer’s instructions. Real-time PCR analysis was performed using the SyBR Green JumpStart kit (Sigma Aldrich) in Rotor Gene Q equipment (Corbett Research, Mortlake, Australia)^{82 (link)}. Gene expression was analyzed by 2^−∆∆CT using RPL37a, cyclophilin B (CyB) and HPRT1 as inner controls^{83 (link)}. Primers of the analyzed genes are exposed in Table S1.

Total RNA was obtained from 100 mg of the tumor, right femur BM or 4 × 106 blood neutrophils by the guanidine isothiocyanate extraction method using TRIzol® Reagent^{30 (link)} (ThermoFisher Scientific, Waltham, Massachusetts, USA). cDNA was synthesized from total RNA (1 µg) using High Capacity cDNA reverse transcription kit (ThermoFisher Scientific, Waltham, Massachusetts, USA), following the manufacturer’s instructions. Real-time PCR analysis was performed using the SyBR Green JumpStart kit (Sigma Aldrich, St. Louis, Missouri, EUA) using QuantiStudio 6 Flex equipment (ThermoFisher Scientific, Waltham, Massachusetts, USA). Gene expression was analyzed by 2^−∆∆CT using RPL37a as inner control. Primers of the analyzed genes are exposed in table S1.

Total RNA was obtained from 1x10⁷ dHL60 by the guanidine isothiocyanate extraction method [34 (link)], using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) followed by isolation using RNeasy mini kit (Qiagen). The purity was assessed by the 260/280 nm ratio and the quantity measured at 260 nm. The cDNA was synthesized from total RNA (1.0 μg) using the High capacity kit (Invitrogen). The following primers were used: ATF4 5´-GACCGAAATGAGCTTCCTGA-3´ and 5´-ACCCATGAGGTTTGAAGTGC-3´; GRP78 5´-GCCTGTATTTCTAGACCTGCC-3´ and 5´-TTCATCTTGCCAGCCAGTTG-3´; C/EBP homologous protein (CHOP) 5´-CTGCTTCTCTGGCTTGGCTG-3´ and 5´-GCTCTGGGAGGTGCTTGTGA-3´; ER-localized DnaJ 4 (ERdJ4) 5´-CGCCAAATCAAGAAGGCCT-3´ and 5´-CAGCATCCGGGCTCTTATTTT-3´; Growth Arrest DNA damage protein 34 (GADD34) 5´-GGAGGAAGAGAATCAAGCCA-3´ and 5´-TGGGGTCGGAGCCTGAAGAT-3´; Glyceraldehyde-3-phosphate dehydrogenase GAPDH 5´-CCACCCATGGCAAATTCCATGGCA-3´ and 5´-TCTAGACGGCAGGTCAGGTCCACC-3´; Homocysteine-induced ER protein (Herp) 5´-CACCGCGACTTGGAGCTGAGTGG-3´ and 5´-TCTGTGGATTCAGCCACCTTGG-3´; 18S 5´-GCAATTATTCCCCATGAACG-3´ and 5´-GGGACTTAATCAACGCAAGC-3´. Real-time PCR analysis was performed using the SyBR Green JumpStart kit (Sigma Aldrich) in a Rotor Gene 6000 equipment (Corbett Research, Mortlake, Australia). Gene expression was performed by 2^-ΔΔCT [35 (link),36 (link)], using GAPDH and 18S genes as inner controls.