Nur77 gfp

All mice used in this study were male and were between 8 and 12 weeks old. We purchased C57BL/6; B6.Cg-Thy1^a/Cy Tg (TcraTcrb)8Rest/J (Pmel); B6.SJL-Ptprc^a Pepc^b/BoyJ (B6 CD45.1); Jak3^–/– (strain 002852); Nur77^GFP and C57BL/6-Tg (TcraTcrb)1100Mjb/J (OT-1) from The Jackson Laboratory. MyrAkt mice with a constitutive Akt activation carrying the transgene was generated by backcrossing onto C57BL/6 background. About 50 % of the offspring carried the transgene, which was identified by genomic PCR screening using the following primers: PKB-forward: 5′ TGACACCAGGTATTTTGATGA 3′ and PKB-reverse: 5′ TGTTGGACCCAGCTTTGCAG 3′. Animals were housed in a barrier facility in air-filtered cages and allowed free access to food and water.

Prior to infection, mice were housed in a specific pathogen-free facility. Control animals for infections were co-housed in the same facility. Mice in equal numbers from both male and female sexes were infected at 8-16 weeks of age with a standard dose of aerosolized Mycobacterium tuberculosis H37Rv, targeting 100-200 CFUs, using an Inhalation Exposure Unit (Glas-Col). Nur77-GFP (strain 016617) and TCRa^-/- (strain 002116) mice were initially purchased from Jackson Labs, then bred in house. Following infection, mice in both experimental groups and controls were housed in the same ABSL3-specific pathogen-free facility. Inoculum size for each infection was confirmed with harvest of 3 C57BL/6 J (Jackson Labs strain 000664) mice 24 hours post-infection. Lungs were homogenized in PBS with Tween 80, then plated on 7H10 agar plates and incubated at 37 °C for 3-4 weeks prior to counting colony-forming units. Schematic diagrams in Figs. 1, 6, and 7 representing mouse experimental infections were partially created with BioRender.com.

C57BL/6, Nur77-GFP, B6 CD45.1, and OT1 were all purchased from The Jackson Laboratory and bred for use in experiments. Studies were initiated when the mice were 6-8 weeks old. Approval for all animal experimental protocols was approved by the Institutional Animal Care and Use Committee at Northwestern University under the protocol number ISO16696. All animals were housed at the Center for Comparative Medicine at Northwestern University in a dedicated pathogen-free animal facility with 12-hour light/12-hour dark cycles and ad libitum access to food and water.

C57BL/6 CD45.2⁺ WT mice were purchased from Taconic Biosciences (Rensselaer, NY, USA) or Japan SLC (Hamamatsu, Japan). Rag2 KO and CD45.1⁺ WT mice were obtained from the National Institute of Allergy and Infectious Diseases (NIAID) contract facility at Taconic Biosciences or breeding stock maintained at Tohoku University Graduate School of Medicine. Nur77-GFP and Foxp3-RFP reporter mice were obtained from Jackson Laboratory (Bar Harbor, ME, USA). CD4-CreERT2 TCRα^flox mice are previously described (5 (link)). All mice were maintained in SPF animal facilities in the NIAID, National Cancer Institute (NCI), National Institutes of Health (NIH), or Tohoku University Graduate School of Medicine except for GF and AF mice, which were bred and maintained in the animal facility of Pohang University of Science and Technology as previously described (33 (link)). All mice were used at the age of 8–16 weeks except in the case of Figures 3A, B, where mice of indicated ages were utilized. The care and handling of the animals used in our studies were in accordance with the animal study protocols approved by the NIAID or NCI Animal Care and Use Committee, by the Institutional Committee for the Use and Care of Laboratory Animals of Tohoku University, or by the Institutional Animal Care and Use Committees of the Pohang University of Science and Technology.

Mice were bred and maintained in the University of Oxford specific pathogen-free (SPF) animal facilities. Mice were routinely screened for the absence of pathogens and were kept in individually ventilated cages with environmental enrichment at 20–24 °C, 45–65% humidity with a 12 h light/dark cycle (7 am–7 pm) with half an hour dawn and dusk period. CD8a-Cre^GFP (JAX stock no.: 008766), IFN-γR^flox/flox (JAX stock no.: 025394), IFN-γ-GREAT-YFP (JAX stock no.: 017580), IFN-γ^KO (JAX stock no.: 002287), Nur77-GFP (JAX stock no.: 018974), CD8aKO (JAX stock no.: 002665) and OT-I (JAX stock no.: 003831) were purchased from Jackson Laboratory. OT-I mice were bred with CD45.1 mice (The Jackson Laboratory – 002014) to generate congenically marked OT-I CD45.1 cells. C57BL/6 J mice were purchased from Charles River, UK (JAX stock number: 000664). To generate CD8 IFN-γR^KO mice CD8a-Cre^GFP mice were crossed with IFN-γR^flox/flox mice, which were subsequently crossed to Rosa26-tdTomato mice (kind gift from Tal Arnon). All experiments involving mice were conducted in agreement with the United Kingdom Animal (Scientific Procedures) Act of 1986 and performed in accordance to approved experimental procedures by the Home Office and the Local Ethics Reviews Committee (University of Oxford).