Pcdna dest40

Cystatin C (Cys C, kind gift of Dr. Efrat Levy, New York University Langone Medical Center) was amplified by polymerase chain reaction (PCR) and inserted into the pENTR1A Dual Selection vector (Life Technologies, Carlsbad, CA) using the BamHI and EcoRI restriction sites. Mutations (A25T and G26K) as well as FLAG-tag insertions (DYKDDDDK) were generated by the Q5 Mutagenesis Kit (New England Biolabs (NEB), Ipswich, MA). Cys C constructs were then recombined into either the pTREx-DEST30, pcDNA-DEST40, pcDNA-DEST47, or pAd/CMV/DEST (Life Technologies) destination vector by an LR Clonase II reaction (Life Technologies). All constructs described herein were expressed in a constitutive manner. Only recombination into the pcDNA47-DEST vector altered the encoded Cys C protein. In this instance, we used a pENTR1A Cys C FLAG entry construct without a stop codon. After recombination into the pcDNA-DEST47 vector, the resulting construct encoded for Cys C FLAG green fluorescent protein (GFP), containing a C-terminal FLAG tag followed by a 22 amino acid linker (WNSRPHSRYLDPAFLYKVVRSR) and then a cycle 3 variant of GFP. All constructs were verified by sequencing.

Prrx1 and Prrx2 expression vectors were constructed using a Gateway cloning system (Life Technologies), according to the manufacturer’s protocol. Briefly, the coding sequences of mouse Prrx1 and Prrx2 cDNA without stop codons were cloned into a pENTR/D-TOPO vector, then the following forward and reverse primers were used: Prrx1, 5′ - caccgggagaccatgacctccagcta - 3′ and 5′- cctgtacggagaggctgtcccccagga - 3′; and Prrx2, 5′ - caccatggacagcgcggccg - 3′ and 5′- gttcactgtgggcacctggc - 3′. Expression vectors were constructed using an LR recombination reaction (pcDNA-DEST40; Life Technologies) tagged with V5-His.

PKP1 and β-catenin expression vectors were constructed using a Gateway cloning system (Life Technologies) according to the manufacturer’s protocol. Briefly, the coding sequences of mouse PKP1 and β-catenin without a stop codon were cloned into a pENTR/D-TOPO entry vector. cDNA was prepared from E14 tooth mRNA by reverse transcription PCR and the sequences were confirmed by DNA sequencing. The following forward and reverse primers were used: PKP1-FL, 5'-caccatgaaccactctccgctcaa-3' and 5'-gaaccgggaggtgaagttt-3'; PKP1-delN1, 5'-caccatgtactgtgacccaaggggcacact-3' and 5'-gaaccgggaggtgaagttt-3'; PKP1-delN2, 5'-caccatgccagcacacctgcttccaggatgaat-3' and 5'-gaaccgggaggtgaagttt-3'; and β-catenin, 5'-caccatggctactcaagctgacctgat-3' and 5'-caggtcagtatcaaacca-3'. Expression vectors were cloned via an LR recombination reaction between the entry clone and destination vectors (Vivid Colors pcDNA6.2/C-EmGFP-DEST and pcDNA-DEST40, respectively; Life Technologies), then tagged with Em-GFP and V5-His, respectively.

Gateway LR reactions were used to transfer ORFs into mammalian expression vectors. The pDEST-DUAL vector for our dual-fluorescence screen was constructed by inserting an mCherry cassette independently driven by a minCMV promoter into pcDNA-DEST47 (Invitrogen, 12281-010), which features a C-terminal GFP tag. PSPH WT, D32N, T152I, and T149M were transferred into a pQCXIP (ClonTech, 631516) vector modified to include a Gateway cassette featuring a C-terminal 3 × FLAG tag. SEPT12 WT, G169E, and D197N were transferred also into this same modified pQCXIP 3 × FLAG vector. SEPT1 was transferred into a modified pcDNA3.1 (Invitrogen, V79020) vector featuring a C-terminal 3 × HA tag. AKR7A2 WT and A142T were transferred into pcDNA-DEST40, which includes a V5 tag (Invitrogen, 12274-015).