Log In Sign up
The largest database of trusted experimental protocols

Scramble shrna shc002

Manufactured by Merck Group
Visit Supplier

Scramble shRNA SHC002 is a laboratory tool used for gene silencing experiments. It serves as a negative control to help researchers assess the effects of RNA interference (RNAi) on gene expression.

Automatically generated - may contain errors

Lab products found in correlation

Plko 1 puro cmv turbogfp lentivirus plasmid, by Merck Group (2 mentions) Ywhaq trcn0000078169, by Addgene (2 mentions) Ywhaz trcn0000029404, by Addgene (2 mentions) Shc003, by Merck Group (2 mentions) Shc003 turbo gfp, by Merck Group (2 mentions) Plko 1 backbone, by Merck Group (2 mentions)

Close spelling variants of this product

SHC002 (202 citations) Scramble shRNA (2 citations)

4 protocols using scramble shrna shc002

1

Generating LNK and shRNA Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pLKO.1-puro-CMV-TurboGFP lentivirus plasmid (SHC003) was obtained from Sigma. The entire coding region of huLNK, including the HIS tag and V5 tag, was amplified from pcDNA3 LNK using primers TGAGCTAGCATGAACGGGCCTGCCCTGCAGCC (Nhe I) and AAACACGTGCTCGAGCGGCCGCCACTGT (Pml I). The PCR product was ligated to pGEM-T vector and validated by Sanger sequencing. This construct was digested with Nhe I and Pml I, the LNK containing fragment was gel purified, and the GFP coding fragment of pLKO-CMV-GFP vector (SHC003) was replaced with the LNK open reading frame (pLKO-CMV-LNK). For gene silencing, shRNA plasmids targeted to LNK [TRCN0000265715 (shRNA15), TRCN0000265716 (shRNA16), TRCN0000256095 (shRNA95) and Scramble shRNA SHC002 were purchased from Sigma. shRNA plasmids targeted to AKT1 (TRCN0000010174), 14-3-3 Q (YWHAQ TRCN0000078169), 14-3-3 Z (YWHAZ TRCN0000029404) and 14-3-3 G (YWHAG TRCN0000078158) were generated according to the protocol described by Addgene (http://www.addgene.org/tools/protocols/plko/). The sequences of all the shRNA constructs were confirmed by Sanger sequencing using the U6 primer.
Ding L.W., Sun Q.Y., Lin D.C., Chien W., Hattori N., Dong X.M., Gery S., Garg M., Doan N.B., Said J.W., Xiao J.F., Yang H., Liu L.Z., Meng X., Huang R.Y., Tang K, & Koeffler H.P. (2014). LNK (SH2B3): paradoxical effects in ovarian cancer. Oncogene, 34(11), 1463-1474.
+ Open protocol
+ Expand
2

Generating LNK and shRNA Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
The pLKO.1-puro-CMV-TurboGFP lentivirus plasmid (SHC003) was obtained from Sigma. The entire coding region of huLNK, including the HIS tag and V5 tag, was amplified from pcDNA3 LNK using primers TGAGCTAGCATGAACGGGCCTGCCCTGCAGCC (Nhe I) and AAACACGTGCTCGAGCGGCCGCCACTGT (Pml I). The PCR product was ligated to pGEM-T vector and validated by Sanger sequencing. This construct was digested with Nhe I and Pml I, the LNK containing fragment was gel purified, and the GFP coding fragment of pLKO-CMV-GFP vector (SHC003) was replaced with the LNK open reading frame (pLKO-CMV-LNK). For gene silencing, shRNA plasmids targeted to LNK [TRCN0000265715 (shRNA15), TRCN0000265716 (shRNA16), TRCN0000256095 (shRNA95) and Scramble shRNA SHC002 were purchased from Sigma. shRNA plasmids targeted to AKT1 (TRCN0000010174), 14-3-3 Q (YWHAQ TRCN0000078169), 14-3-3 Z (YWHAZ TRCN0000029404) and 14-3-3 G (YWHAG TRCN0000078158) were generated according to the protocol described by Addgene (http://www.addgene.org/tools/protocols/plko/). The sequences of all the shRNA constructs were confirmed by Sanger sequencing using the U6 primer.
Ding L.W., Sun Q.Y., Lin D.C., Chien W., Hattori N., Dong X.M., Gery S., Garg M., Doan N.B., Said J.W., Xiao J.F., Yang H., Liu L.Z., Meng X., Huang R.Y., Tang K, & Koeffler H.P. (2014). LNK (SH2B3): paradoxical effects in ovarian cancer. Oncogene, 34(11), 1463-1474.
+ Open protocol
+ Expand
3

Cloning FAT1 and ZNF750 ORFs

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The open reading frame (ORF) of human FAT1 and ZNF750 transcripts were generously provided by Timothy Chan's group from Memorial Sloan-Kettering Cancer Center27 (link) and Paul Khavari's group from Veterans Affairs Palo Alto Healthcare System24 (link), respectively. Both ORFs were sub-cloned into lentiviral based expression vector SHC003 (Sigma-Aldrich) using Nhe I and Fse I cloning sites. SHC003-Turbo-GFP was used as control (Sigma-Aldrich). The lentiviral based shRNA vectors (shXPO1 and shFAT2 sequences are listed in Supplementary Table 13b) were generated with PLKO.1 backbone (Sigma-Aldrich) using Age I and EcoR I cloning sites. SHC002-Scramble shRNA was used as control (Sigma-Aldrich). The cloning primers are listed in Supplementary Table 13c.
Lin D.C., Hao J.J., Nagata Y., Xu L., Shang L., Meng X., Sato Y., Okuno Y., Varela A.M., Ding L.W., Garg M., Liu L.Z., Yang H., Yin D., Shi Z.Z., Jiang Y.Y., Gu W.Y., Gong T., Zhang Y., Xu X., Kalid O., Shacham S., Ogawa S., Wang M.R, & Koeffler H.P. (2014). Genomic and molecular characterization of esophageal squamous cell carcinoma. Nature genetics, 46(5), 467-473.
+ Open protocol
+ Expand
4

Cloning FAT1 and ZNF750 ORFs

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The open reading frame (ORF) of human FAT1 and ZNF750 transcripts were generously provided by Timothy Chan's group from Memorial Sloan-Kettering Cancer Center27 (link) and Paul Khavari's group from Veterans Affairs Palo Alto Healthcare System24 (link), respectively. Both ORFs were sub-cloned into lentiviral based expression vector SHC003 (Sigma-Aldrich) using Nhe I and Fse I cloning sites. SHC003-Turbo-GFP was used as control (Sigma-Aldrich). The lentiviral based shRNA vectors (shXPO1 and shFAT2 sequences are listed in Supplementary Table 13b) were generated with PLKO.1 backbone (Sigma-Aldrich) using Age I and EcoR I cloning sites. SHC002-Scramble shRNA was used as control (Sigma-Aldrich). The cloning primers are listed in Supplementary Table 13c.
Lin D.C., Hao J.J., Nagata Y., Xu L., Shang L., Meng X., Sato Y., Okuno Y., Varela A.M., Ding L.W., Garg M., Liu L.Z., Yang H., Yin D., Shi Z.Z., Jiang Y.Y., Gu W.Y., Gong T., Zhang Y., Xu X., Kalid O., Shacham S., Ogawa S., Wang M.R, & Koeffler H.P. (2014). Genomic and molecular characterization of esophageal squamous cell carcinoma. Nature genetics, 46(5), 467-473.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!