Log In Sign up
The largest database of trusted experimental protocols

Hexamethylenetetramine

Manufactured by Sinopharm
Visit Supplier
Sourced in China

Hexamethylenetetramine is a chemical compound with the formula (CH2)6N4. It is a white, crystalline solid that is soluble in water and organic solvents. The compound's primary function is as an intermediate in the production of various chemicals and pharmaceutical products.

Automatically generated - may contain errors

Lab products found in correlation

Hydrochloric acid (hcl), by Sinopharm (5 mentions) Hydrogen peroxide, by Sinopharm (3 mentions) Zinc nitrate hexahydrate, by Sinopharm (3 mentions) L ascorbic acid, by Sinopharm (3 mentions) Zinc acetate dihydrate, by Sinopharm (2 mentions) Sulfuric acid, by Sinopharm (2 mentions) Potassium permanganate, by Sinopharm (2 mentions) Ethanol, by Sinopharm (2 mentions) Copper nitrate trihydrate, by Sinopharm (2 mentions) Cobalt nitrate hexahydrate, by Sinopharm (2 mentions) Thioacetamide, by Sinopharm (2 mentions) Zinc acetate, by Sinopharm (2 mentions) Urea, by Sinopharm (2 mentions) Cyclohexane, by Sinopharm (2 mentions) Sodium hydroxide (naoh), by Sinopharm (2 mentions) N formyl methionyl leucyl phenylalanine, by Merck Group (1 mentions) Potassium nitrate, by Sinopharm (1 mentions) Dimethylformamide, by Sinopharm (1 mentions) Absolute ethanol, by Sinopharm (1 mentions) Polyvinylpyrrolidone, by Sinopharm (1 mentions)

Spelling variants of this product

Hexamethylenetetramine (C6H12N4), (2 citations)

17 protocols using hexamethylenetetramine

1

Synthesis of Graphene-Based Nanomaterials

Check if the same lab product or an alternative is used in the 5 most similar protocols
Sulfuric acid (H2SO4, 98%), hydrochloric acid (HCl, 37%), potassium nitrate (KNO3), potassium permanganate (KMnO4), hydrogen peroxide (H2O2, 30%), ethanol, zinc nitrate hexahydrate (Zn(NO3)2·6H2O), zinc acetate dihydrate (Zn(CH3COO)2)·2H2O, hexamethylenetetramine (C6H12N4), and copper nitrate trihydrate (Cu(NO3)2·3H2O) were purchased from the Sinopharm Chemical Reagent Co., Ltd. 1-Butyl-3-methylimidazolium tetrafluoroborate ([BMIM][BF4]), hydroiodic acid (HI, 48%), and worm-like expanded graphite powder (50 mesh number) were purchased from Shanghai Aladdin Biochemical Technology Co. Ltd. Guanine (G), adenine (A), cytosine (C), uracil (U), ascorbic acid (AA), D(+)-glucose (Glu), uric acid (UA), and dopamine (DA) were purchased from the Macklin Co. Ltd. N-formylmethionyl-leucyl-phenyl-alanine (fMLP, ≥99.5%) was obtained from Sigma-Aldrich (United States). All chemicals and reagents are of analytical grade and used without any further purification.
Huang W., Xu Y, & Sun Y. (2022). Functionalized Graphene Fiber Modified With MOF-Derived Rime-Like Hierarchical Nanozyme for Electrochemical Biosensing of H2O2 in Cancer Cells. Frontiers in Chemistry, 10, 873187.
+ Open protocol
+ Expand
2

Synthesis of Zinc-Cobalt Nanostructures

Check if the same lab product or an alternative is used in the 5 most similar protocols
Zinc acetate dihydrate (Zn(CH3COO)2·2H2O) and anhydrous ethanol were purchased from Aladdin Biochemistry Technology Co., Ltd. (Shanghai, China). Cobalt nitrate hexahydrate (Co(NO3)2·6H2O), zinc nitrate hexahydrate (Zn(NO3)2·6H2O), and hexamethylenetetramine (HMTA) were provided by Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). The conductive silver paste was obtained from Guangzhou Techno Electronic Technology Co., Ltd. (Guangzhou, China). PDMS prepolymer and curing agent were purchased from Dow Corning Chemical Co., Ltd. (America). All chemicals were of analytical grade and used without further purification.
Niu F., Zhou F., Wang Z., Wei L., Hu J., Dong L., Ma Y., Wang M., Jia S., Chen X, & Tong Z. (2023). Synthesizing Metal Oxide Semiconductors on Doped Si/SiO2 Flexible Fiber Substrates for Wearable Gas Sensing. Research, 6, 0100.
+ Open protocol
+ Expand
3

Synthesis and Characterization of Zinc Oxide Nanofibers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Absolute ethanol (C2H5OH, 99.7%), dimethylformamide (DMF, C3H7NO, 99.5%), zinc acetate dihydrate (Zn(CH3COOH)2·2H2O, 99%), hexamethylenetetramine (HMTA, 99%), zinc nitrate hexahydrate (Zn(NO3)2·6H2O, 99%) and polyvinylpyrrolidone (PVP, 99.5%, MW = 1,300,000) were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). These chemicals were of analytical grades and used without further purification. The electrospinning needle with a 0.33 mm inner diameter was purchased from Suzhou Lanbo Dispensing Needle Co., Ltd. (Suzhou, China).
Fan C., Sun F., Wang X., Huang Z., Keshvardoostchokami M., Kumar P, & Liu B. (2019). Synthesis of ZnO Hierarchical Structures and Their Gas Sensing Properties. Nanomaterials, 9(9), 1277.
+ Open protocol
+ Expand
4

Adsorption and Catalysis Reagents Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
All the chemicals in the experiments were of analytical reagent grade and used without further purification. Ammonium molybdate ((NH4)6Mo7O24·4H2O), hexamethylenetetramine (C6H12N4), active charcoal powder, cadmium nitrate tetrahydrate (Cd(NO3)2·4H2O), and Na2S, chloroplatinic acid hexahydrate (H2PtCl6·6H2O) were purchased from Sinopharm Chemical Reagent Co., Ltd, China.
Jing X., Peng X., Cao Y., Wang W, & Wang S. (2018). Enhanced photocarriers separation of novel CdS/pt/Mo2C heterostructure for visible-light-driven hydrogen evolution. RSC Advances, 8(59), 33993-33999.
+ Open protocol
+ Expand
5

Synthesis and Characterization of Metal Nanoparticles

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tetrachloroauric acid tetrahydrate (HAuCl4·4H2O), sodium citrate tribasic dihydrate (TSC, 99.0%), silver nitrate (AgNO3, 99.0%), hydrochloric acid (HCl, 36.0−38.0 wt%), L-ascorbic acid (AA, 99.0%), ammonia solution (NH3H2O, 25.0−28.0 wt%), hydrogen peroxide (H2O2, 30.0 wt%), hexamethylenetetramine (HMT, 99.5%), thioacetamide (TAA, 99%), and cadmium acetate (CH3COO)3Cd were purchased from Sinopharm Chemical Reagent Co. Ltd. (Shanghai, China). Sodium borohydride (NaBH4, 99%), hexadecyltrimethylammonium chloride (CTAC, 97%), hexadecyltrimethylammonium bromide (CTAB, 99.0%), sodium iodide (NaI, 99.5%), and potassium chloroplatinite (K2PtCl6, 99.5%) were purchased from Aladdin Reagent. The chemicals were not further purified and were used straight from the original packaging. Deionized (DI) water with a resistivity of 16.8 Ω·cm was used throughout the experiments.
Yan H., Li G., Zhang F., Liu J, & Luoshan M. (2024). Synthesis of Structure-Adjustable R-Au/Pt-CdS Nanohybrids with Strong Plasmon Coupling and Improved Photothermal Conversion Performance. Nanomaterials, 14(10), 838.
+ Open protocol
+ Expand
6

Synthesis and Characterization of Naphthol Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols
Naphthol (AR), hexamethylene tetramine (AR) and NH2NH2·H2O (AR) were purchased from Sinopharm Chemical Reagent Co., Ltd., Shanghai, China; acetic acid (AR) was purchased from Shanghai Tree of Science & Technology Co., Ltd., Shanghai, China; absolute ethyl alcohol (AR) and metal salt solutions were purchased from Tianjin kaitong chemical reagent Co., Ltd., Tianjin, China.
FT-IR spectrometer (NEXUS-670), Nicolay corporation, Phoenix, AZ, USA; Nuclear magnetic resonance (AV-400) spectrometer, Bruker, Karlsruhe, Germany; 970CRT fluorescence spectrophotometer, Shanghai Instrument Analysis Factory, Shanghai, China; vacuum drying oven (DZF-6020A), Shanghai Kuntian Company, Shanghai, China; electric thermostatic water bath (HWS-12), Shanghai Yiheng Company, Shanghai, China.
Li Q., Ma L., Li J., Wang L., Yu L., Zhao Y, & Lv Y. (2023). Study of a Fluorescent System Based on the Naphthalene Derivative Fluorescent Probe Bound to Al3+. Micromachines, 14(4), 868.
+ Open protocol
+ Expand
7

Synthesis of Metal-Organic Compounds

Check if the same lab product or an alternative is used in the 5 most similar protocols
All chemicals utilized in this work, including zinc acetate (Zn(CH3COO)2•2H2O), ammonium fluoride (NH4F), aluminum nitrate (Al(NO3)3•9H2O), and hexamethylenetetramine (HMT), were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China) and were of analytical grade, which can be used without any purification.
Yao X., Wang R., Wu L., Song H., Zhao J., Liu F., Fu K., Wang Z., Wang F, & Liu J. (2023). Highly Efficient NO2 Sensors Based on Al-ZnOHF under UV Assistance. Materials, 16(9), 3577.
+ Open protocol
+ Expand
8

Synthesis of Transition Metal Complexes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hydrochloric acid (HCl), nickel nitrate hexahydrate (Ni(NO3)2·6H2O), triethanolamine (C6H15O3N, TEOA), sulfuric acid (H2SO4), cobalt nitrate hexahydrate (Co(NO3)2·6H2O), acetonitrile (CH3CN, MeCN), deuterium oxide (D2O), copper nitrate trihydrate (Cu(NO3)2·3H2O), hexamethylenetetramine (C6H12N4, HMTA), hydrogen peroxide (H2O2), iron nitrate nonahydrate (Fe(NO3)3·9H2O), potassium permanganate (KMnO4), trisodium citrate (C6H5O7Na3) and urea (CH4N2O) were supplied by Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Cis-Dichlorobis(2,2-bipyridine)ruthenium(II) ([Ru(bpy)2]Cl2) were purchased form Sigma-Aldrich Co., Ltd (Shanghai, China). All chemicals were analytical grade and used as received. Deionized (DI) water was obtained from local sources.
Lu K.Q., Li Y.H., Zhang F., Qi M.Y., Chen X., Tang Z.R., Yamada Y.M., Anpo M., Conte M, & Xu Y.J. (2020). Rationally designed transition metal hydroxide nanosheet arrays on graphene for artificial CO2 reduction. Nature Communications, 11, 5181.
+ Open protocol
+ Expand
9

Synthesis and Characterization of MAX Phase Materials

Check if the same lab product or an alternative is used in the 5 most similar protocols
LiF was purchased from Aladdin Reagents (Shanghai), 200 mesh MAX Ti3AlC2 was purchased from 11 technology co.,LTD, hydrochloric acid (HCl), Zinc nitrate hexahydrate (Zn(NO3)2), Hexamethylenetetramine (HMTA), potassium permanganate were purchased from Sinopharm Chemical Reagent Co. Ltd. (China), Rhodamine 6G (R6G), methylene blue (MB), acid blue (AB), crystal violet (CV) were purchased from MACKLIN. All chemicals were used as received without further purification. miRNA with sequence of UUUGUACUACACAAAAGUACUG (sense(5'-3')) was purchased from RIBOBIO co.,LTD.
Wu Z., Zhao D., Han X., Liu J., Sun Y., Li Y, & Duan Y. (2023). Deposition of hydrophilic Ti3C2Tx on a superhydrophobic ZnO nanorod array for improved surface-enhanced raman scattering performance. Journal of Nanobiotechnology, 21, 17.
+ Open protocol
+ Expand
10

Synthesis of Copper Nanostructures

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cu(ii) nitrate trihydrates (Cu(NO3)2·3H2O, ≥99%), l-ascorbic acid (≥99%), cetyltrimethylammonium bromide (CTAB, ≥99%), and hexamethylenetetramine (HMTA, ≥99%) were purchased from Sinopharm Chemical Reagent Co., Ltd. All chemicals were used as received without further purification. In a typical synthesis experiment,27 (link) Cu(NO3)2·3H2O (50 mg) and l-ascorbic acid (100 mg) were dissolved with 15 mL of deionized water in a glass vial (20 mL). After forming a homogeneous solution, CTAB (100 mg) and HMTA (100 mg) were added. After 30 min of stirring, the vial of the solution was capped and heated from room temperature to 80 °C and kept at 80 °C for 6 h in a water bath. The products were collected by centrifugation at 10 000 rpm and washed three times ethanol.
Li C, & Chen M. (2020). Active site-dominated electromagnetic enhancement of surface-enhanced Raman spectroscopy (SERS) on a Cu triangle plate. RSC Advances, 10(69), 42030-42037.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!