The largest database of trusted experimental protocols

9 protocols using primescript rt reagent kit for rt pcr

1

Quantifying Gene Expression in Lung Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from lung tissues stored in RNAlater or from the rat alveolar epithelial cell line using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. After determining RNA concentration, 1 µg RNA was used for cDNA synthesis using the PrimeScript™ RT Reagent kit for RT-PCR (Takara Bio, Inc.), according to the manufacturer's protocol. qPCR analysis was performed on cDNA using the ABI7500 instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.) with TB Green® Premix Ex Taq™ II kit (Takara Bio, Inc.), according to the manufacturer's protocol. The thermocycling conditions were as follows: Pre-conditioning at 95°C for 30 sec; annealing for 5 sec at 95°C and amplification for 15 sec at 60°C for 40 cycles; final extension for 10 sec at 60°C. The relative mRNA expression levels were normalized the internal reference gene GAPDH using the 2−ΔΔCq cycle threshold method (23 (link)). The primer sequences for qPCR are listed in Table I.
+ Open protocol
+ Expand
2

Poplar Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
First strand cDNA was synthesized from 1.0 μg total RNA digested by DNase I by using the PrimeScript™ RT reagent Kit for RT-PCR (Takara, China), according to the manufacturer's instructions. The specific primers for poplar were synthesized by the Shanghai Sangon biotechnology company (Shanghai, China). qRT-PCR used a SYBR Premix ExTaq™ kit (Takara, China) in an ABI 7500. To quantify the relative expression level of the target genes, the poplar reference gene Actin (GenBank Accession No. AY261523.1/U60491) was used as the internal control. The Actin gene primer pairs were as follow: forward, 5′-CTCCATCATGAAATGCGATG-3′; reverse, 5′-TTGGGGCTAGTGCTGAGATT-3′ (Du et al., 2013a (link)). Three independent biological replicates were performed for each selected gene (two time technical repeats per biological replicate).
+ Open protocol
+ Expand
3

Quantitative analysis of α7nAChR expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from the lung tissue by using a TRizol reagent (Sigma-Aldrich). cDNA was synthesized using a PrimeScript RT Reagent kit for RT-PCR (TAKARA BIO INC, Japan). qPCR analysis of α7nAChR and GAPDH was performed in the Real-time Detection System Roche LightCycler480 II, Switzerland by ChamQSYBR qPCR Master Mix (Vazyme, Nanjing, China) detection. Equal amounts of RNA (500 ng) were used to prepare cDNA. The primers used were as follows: α7nAChR, sense GGCAAAATGCCTAAGTGGAC, antisense CTTCATGCGCAGAAACCAT; GAPDH, sense AACTTTGGCATTGTGGAAGG, antisense CACATTGGGGGTAGGAACAC. The fold change of the target gene cDNA relative to GAPDH was determined as follows: fold change = 2−ΔΔCt, where ΔΔCt = (Ct Target-Ct GADPH) test − (Ct Target-Ct GADPH) control. GAPDH served as an internal standard control for variations in RT-PCR efficiency.
+ Open protocol
+ Expand
4

Phosphate-Mediated Gene Expression in HepG-2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HepG-2 cells (1 × 105) were cultured in the four media conditions mentioned above for 1 h, and an additional fifth group was incubated in Pi-free medium with DOX (1 µM) for 1 h. Then, the Pi concentration was elevated to the normal level (125 mg/L) for an additional 1 h. Total RNA from cells in these plates was isolated using an RNA Purification Kit (Tiangen, Beijing, China) and reverse transcribed using a Prime Script RT Reagent Kit for RT-PCR (Takara, Otsu, Japan). For quantitative PCR, template cDNA, primers, and TaqMan Gene Expression Master Mix were used according to the manufacturer’s instructions. Three replicate wells were tested per group, and the relative amount of each gene was normalized to the amount of β-actin using the calculation method of 2–ΔΔt and then reported as the fold change at the basal level. The sequences of the primers used for RT-PCR are listed in Supplemenatry Appendix 8.
+ Open protocol
+ Expand
5

Quantitative PCR Analysis of Ischemic Liver

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the ischemic right liver lobe by using the TRIzon method (Invitrogen, CA, USA). The first strand of cDNA was synthesized by using a PrimeScript RT Reagent kit for RT-PCR (Takara, Otsu, Japan). The primers were used as follows (Table 1): GAPDH was the control with the following primers. All data were calculated according to the 2−ΔΔCT method: ΔΔCt = (Ct Target−Ct GAPDH) test−(Ct Target – Ct GAPDH) control. Control was defined as 1.0 fold.
+ Open protocol
+ Expand
6

Quantifying Adipogenesis via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was prepared from frozen tissue or cells using TRIzol reagent (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer’s protocol. Total RNA was quantitated and reverse transcribed with PrimeScript RT-reagent Kit for RT-PCR (Takara Biotechnology Co., Ltd., Dalian, China). Quantitative PCR was performed using the Bio-Rad iQ5 real-time PCR detection system using SYBR Premix Ex TaqTM II (Takara Biotechnology Co., Ltd., Dalian, China). The Bulge-LoopTM miRNA qRT-PCR primer set for miRNAs detection were obtained from Guangzhou RiboBio Co. (Guangzhou, China), and U6 was used as internal control. For adipocyte marker genes, including PPARγ, C/EBPα, FABP4 and LPL, expression was normalized to β-actin. Primers for qPCR were (F forward, R reverse): miR-196a-1 F: 5′-CCGCCTAGGTAGTTTCATGTTGT-3′, R: 5′-AATCCATGAGAGATCCCTACCG-3′. U6 F: 5′-ATTGGAACGATACAGAGAAGATT-3′, R: 5′-GGAACGCTTCACGAATTTG-3′. PPARγ F: 5′-AGGACTACCAAAGTGCCATCAAA-3′, R: 5′-GAGGCTTTATCCCCACAGACAC-3′. C/EBPα F: 5′-TGTTGGGGATTTGAGTCTGTG-3′, R: 5′-GGAAACCTGGCCTGTTGTAAG-3′. FABP4 F: 5′-GAGCACCATAACCTTAGATGGA-3′, R: 5′-AAATTCTGGTAGCCGTGACA-3′. LPL F: 5′-GGAGAGAGGAAGGGAAAACAGAG-3′, R: 5′-AGACCGACCAATAAACTGCAAAG-3′. β-actin F: 5′-GGACTTCGAGCAGGAGATGG-3′ R: 5′-AGGAAGGAGGGCTGGAAGAG-3′.
+ Open protocol
+ Expand
7

Quantitative RT-PCR Analysis of Poplar Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA was synthesized from 1.0 µg total RNA and digested with DNase I using a PrimeScript RT reagent kit for RT-PCR (Takara, Dalina, China) according to the manufacturer’s instructions. The specific primers for poplar (Table S1) were synthesized by the Sangon Biotechnology Company (Shanghai, China). Real-time quantitative RT-PCR was performed with a SYBR Premix ExTaqTM II kit (Takara) with a Roche LightCycler 480 (Roche, Penzberg, Germany). To quantify the relative expression levels of the target genes, the reference gene β-TUB from P. massoniana was used as the internal control [51 (link)], and the primer sequences were as follows: 5’-GTCGTGAATCATGGCATGGC-3’ (forward); 5’-GCCTCACTATCGGTTTCCCA-3’ (reverse). Fold changes were calculated by the relative expressions of treatments compared to the control. Three independent biological repeats were performed for each selected gene (at least two technical repeats per biological repeat).
+ Open protocol
+ Expand
8

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from samples using QIAzol® RNA Lysis reagent (QIAGEN, Hilden, Germany), after which cDNAs were synthesized using a PrimeScript™ RT reagent Kit for RT-PCR (Takara Bio Inc., Otsu, Japan) according to the manufacturer’s instructions. Quantitative PCR was performed using an ABI 7300 Prism SDS real-time PCR detection system (Applied Biosystems, Foster City, CA, USA) with a SYBR® Premix Ex Tag kit (Takara Bio Inc., Otsu, Japan) and a standard temperature protocol. The results obtained using CT (cycle threshold) were expressed as relative quantities and were calculated using the 2-ΔΔCT method (expressed as relative fold ratio). Hypoxanthine phosphoribosyltransferase 1 (HPRT1) was used as a control gene for normalization, and three separate experiments were performed. Detailed primer information is shown in Figure 2.
Primers used for the quantitative real-time PCR
+ Open protocol
+ Expand
9

RT-PCR Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using RNAiso Plus reagent (Takara, Japan) and reverse transcribed with a PrimeScript RT reagent kit for RT‐PCR (Takara, Japan), following the manufacturers’ protocols. RT‐PCR was performed using an ABI Prism 7500 Sequence Detector (Applied Biosystems, Foster City, CA). The expression level of target genes was analysed by the relative quantity (RQ) value calculated using the ΔΔCt method. Experiments were performed in triplicates for each sample. Table S1 provides details regarding the primers used in our study.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!