Sequenom massarray system

Patients with CRC have their tumor tested for downstream activators of the EGFR signaling pathway at our institution as part of standard of care. Tumor specimens were obtained via primary site specimen (17/40), liver biopsy (20/40), lymph node biopsy (2/40), or lung metastasis biopsy (1/40). After microscopic examination confirmed the diagnosis of adenocarcinoma, tissue was sent to a molecular diagnostic laboratory in the Department of Pathology for extraction of genomic DNA. All samples were determined to have adequate DNA quality prior to testing. Tumors were genotyped using (a) the Sequenom Mass Array system (Sequenom, Inc.), where samples are tested in duplicate using multiplexed assays to interrogate mutations in hotspots of KRAS, BRAF, NRAS, MEK1, PIK3CA, and AKT1[36 (link)] or (b) a previously reported hybridization capture-based next generation sequencing assay for targeted deep sequencing of all exons and selected introns of key cancer genes [37 (link)]. For the next generation sequencing assay that includes 8/40 (20%) of samples, we only include data related to the hotspot mutations tested in the Sequenom assay.

Fasting venous blood was collected from the peripheral vein. DNA was extracted using a Puregene kit (Gentra Systems, Inc., Minneapolis, MN, USA). Quality control was performed at the DNA-sample level, assay level, and the level of multiplex assay pool. The call rates for the SNPs included in this study were between 99.4 and 99.7%. KIBRA rs17070145 was genotyped using the Sequenom Mass Array system (Sequenom Inc., San Diego, CA, USA) with technical support from CapitalBio Technology (Beijing, China). Mass determination was carried out with the MALDI-TOF mass spectrometer and Mass ARRAY Type 4.0 software was used for data acquisition.
Among individuals included in the study, frequencies of genotypes in the KIBRA rs17070145 polymorphism were T/T in 53 subjects (53%), C/T in 37 subjects (37%), and C/C in 10 subjects (10%). Allelic frequencies were in line with previous reports and Hardy Weinberg Equilibrium was p = 0.62 for rs17070145.

Blood samples were collected from all the study subjects in a sterile tube containing EDTA, and genomic DNA was extracted from peripheral blood leukocytes. The DNA samples were stored at −80 °C until genotyping. All individuals included in the present study were genotyped for the two non-synonymous variants SLCO1B1 c.521T > C and SLCO1B1 c.388A > G using the matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) and Sequenom MassARRAY system (Sequenom, San Diego, CA, USA). Genotyping was determined without knowledge of the controls/coughers status of subjects. The accuracy of the two SNPs genotyping data was validated by PCR-products directed sequencing of 5% masked, random samples of the patients.

Genomic DNA was extracted from peripheral blood samples and genotyped at the Mutation Analysis Facility at the Karolinska Institute, Huddinge, Sweden in a masked study design. Genotyping was conducted with a single-nucleotide extension reaction, with allele detection by mass spectrometry (SequenomMassArray system; Sequenom, San Diego, CA). Polymerase chain reaction (PCR) and extension primers were designed using the MassArray assay design software. The genotyping success rate for the SNPs rs879606, rs907094, and rs3764352 was 100%. Since rs907094 and rs3764352 were in complete linkage disequilibrium, only rs907094 was considered in the study analyses.

The commercially available DNeasy Blood & Tissue Kit (Qiagen Ltd., West Sussex, UK) was used, and according to manufacturer’s protocol, to DNA extraction for the HL patients from formalin-fixed paraffin-embedded tissue. Genomic DNA from control-subjects’ blood samples was extracted using the QIAamp® or Promega DNA Mini Kit according to the manufacturer’s instruction. The quality of extracted DNA was examined using agarose gel electrophoresis and ethidium bromide staining. The concentration and purity of extracted DNA were assessed using a NanoDrop 1000® spectrophotometer. The SNP was genotyped using the Sequenom MassARRAY® system (iPLEX GOLD). The pure DNA samples with their concentrations were sent to the Australian Genome Research Facility (AGRF, Melbourne Node, Melbourne, Australia) for genotyping of SNP rs5743836 (TLR9-1237T>C) in all subjects (patients and controls). The SNP, SNP’s position, and primer sequences for TLR9 gene are shown in Table 1. Genotyping with the Sequenom MassARRAY® system (iPLEX GOLD) (Sequenom, San Diego, CA, USA) was performed at the AGRF according to the manufacturer’s recommendations (Sequenom, San Diego, CA, USA). Genotype distributions were compared between patients and controls. Unconditional logistic regression analysis was used to estimate the association between the genotype frequency and the risk of developing HL.

Genomic DNA was extracted using a whole blood DNA extraction kit (Axygen Biosciences, Union City, USA), and stored at -80°C for genotyping. DNA concentrations were measured by TU1901 spectrophotometry, which was purchased from Purkinje General Company (Beijing, China). Concentrations exceeded 20 μg/ml. Sequenom MassARRAY system purchased from Sequenom Inc. (San Diego, CA, USA) was used to determine the genetic sequence for genotyping. The sequence analysis was performed at the Shanghai Fenglin Clinical Laboratory [33 ]. The primer sequences for PRL rs1341239 were as follows: forward-5’-ACGTTGGATGCAGGTCAAGATAACCTGGAG-3’, reverse-5’-ACGTTGGATGATCACACTCAACCAGTTGGC-3’, extent-5’- AACCTGGAGAAAGGAGGAAAGA -3’.
Blinded blood duplicates were used for the sequencing quality control.