Cfx96 real time rt pcr detection system

otal RNA was extracted from cells or tissues using TRIzol (Invitrogen, 15,596,018) following the manufacturer's instructions. Real-time PCR analysis was performed using the Bio-Rad iQ SYBR Green Supermix with Opticon 2 (Bio-Rad) on a CFX96 real-time RT-PCR detection system (Bio-Rad) following a previously described protocol.

Total RNA was extracted from induced EC-like cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. cDNA was synthesized from the total RNA using an RT kit following the manufacturer's protocol (Beijing TransGen Biotech Co., Ltd.). qPCR was performed using a SYBR Premix EX Taq kit following the manufacturer's protocol (Takara Biotechnology Co., Ltd., Dalian, China) with β-actin as an internal control. The final volume was 10 µl, containing 1 µl forward primer and 1 µl of reverse primer. PCR products were measured using the CFX96 Real-Time RT-PCR detection system (Bio-Rad Laboratories, Inc.), and the relative gene expression was calculated using the 2^−∆∆Cq method (32 (link)) using CFX96 Manager Software v2.0 (Bio-Rad Laboratories, Inc.). Thermocycling conditions were as follows: Initial denaturation at 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec, 60°C for 30 sec and 72°C for 15 sec. The primers used for RT-qPCR were as follows: Cx37, forward 5′-CCTTGTGCATCTCCAGGTCC-3′ and reverse 5′-GAAGACCACCAGCACAGTGA-3′; Cx40, forward 5′-AAAGGAAGCCAGAAGGCTCGG-3′ and reverse 5′-CCGATGACTGTGGAGTGCTT-3′; Cx43, forward 5′-TGAGGGAAGTACCCAACAGC-3′ and reverse 5′-TCTGGGCACCTCTCTTTCACT-3′; β-actin, forward 5′-ACCACAGGCATTGTTCTGGA-3′ and reverse 5′-AGGGCGACGTAACACAGTTT-3′.

MCF-7 cells were suspended in a High Pure RNA Isolation Kit (RNAiso Plus, Takara Bio, Japan) and total RNA was extracted. Then, the RNA was reversely transcripted into cDNA with a PrimeScript RT Regent Kit (Takara Bio, Japan). The quantitative real-time PCR (qPCR) reactions were performed in a CFX96 real-time RT-PCR detection system (Bio-Rad, USA). The primers used in this study were as follows:

mdr1: forward primer: GCTGGGAAGATCGCTACTGA;

reverse primer: GGTACCTGCAAACTCTGAGCA;

p53: forward primer: CCATGAGCGCTGCTCAGAT;

reverse primer: CAACCTCAGGCGGCTCATA;

G6PD: forward primer: GGCAACAGATACAAGAACATGAA;

reverse primer: CCCTCATACTGGAAACCCACT;

β-actin: forward primer: GCGTGACATTAAGGAGAAG;

reverse primer: GAAGGAAGGCTGGAAGAG.

The qPCR conditions included 95 °C initial denaturation for 90 s, followed by 40 cycles of denaturation (10 s at 95 °C), annealing (30 s at 60 °C) and extension (30 s at 72 °C). A melting curve was used to monitor the specificity of the primer. The relative expressions of the detected genes were normalized to the expression of the reference gene β-actin.