The RNA samples were extracted using the RNAprep Pure Plant Plus Kit (TIANGEN BIOTECH, Beijing, China), and their quality was assessed through agarose gel electrophoresis and spectrophotometry. TranScript-All-in-One First-Strand cDNA Synthesis SuperMix (TransGen, Beijing, China) reverse transcription kit was used to obtain cDNA. Primers were designed by using the CDS sequence of GauERF105. cDNA of G. australe was used as a template, and P505 high-fidelity polymerase (Vazyme, Nanjing, China) was used to amplify the target gene. Amino acid sequences of other cotton ERF members from the NCBI website were downloaded. DNAMAN software was used for multiple sequence alignment, and MEGA-X was used to construct a phylogenetic tree.
Transcript all in one first strand cdna synthesis supermix
Manufactured by Transgene
Sourced in China
TranScript All-in-One First-Strand cDNA Synthesis SuperMix is a laboratory reagent used for the reverse transcription of RNA into complementary DNA (cDNA). It provides all the necessary components for a single-step cDNA synthesis reaction.
Automatically generated - may contain errors
Lab products found in correlation
Transstart tip green qpcr supermix, by Transgene (5 mentions)
Trizol reagent, by Transgene (4 mentions)
Rnaiso plus kit, by Takara Bio (2 mentions)
Sybr primescript rt pcr kit, by Takara Bio (2 mentions)
7900ht fast real time pcr system, by Thermo Fisher Scientific (2 mentions)
Realplex pcr system, by Eppendorf (2 mentions)
Rnaprep pure plant plus kit, by Tiangen Biotech (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Trizol, by Transgene (1 mentions)
Trizol, by Takara Bio (1 mentions)
Trizol up, by Transgene (1 mentions)
7500 fast real time pcr system, by Thermo Fisher Scientific (1 mentions)
Superreal premix plus sybr green, by Tiangen Biotech (1 mentions)
Cfx96 instrument, by Bio-Rad (1 mentions)
Ssofast evagreen supermix kit, by Bio-Rad (1 mentions)
Transzol up kit, by Transgene (1 mentions)
Linegene 9600 plus, by Bioer (1 mentions)
Quantifast sybr green pcr kit, by Qiagen (1 mentions)
14 protocols using transcript all in one first strand cdna synthesis supermix
1
Cloning and Phylogenetic Analysis of Cotton ERF
2
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from HPGs of 15 9-day-old workers using a RNAiso Plus kit (Takara Beijing, China) according to a standard protocol. cDNA was obtained from 1 μg total RNA by reverse transcription using a Transcript All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China) following instructions. Reverse transcription quantitative PCR (qRT-PCR) was carried out on a ABI 7500 Real Time PCR System (Applied Biosystems, Waltham, MA, USA) with an SYBR PrimeScript RT-PCR kit (Takara, Beijing, China). The transcript levels of genes were quantified using the 2−ΔΔCT method. The primers used for qRT-PCR are listed in Table S1 .
3
Quantitative Analysis of IFN-β and hnRNPA2B1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mouse liver total RNA and cellular RNA were extracted using TRIzol reagent (TransGene Biotech, Beijing, China) and then transcribed into cDNA using TranScript All-in-One First-Strand cDNA Synthesis SuperMix (TransGene Biotech) as instructed by the manufacturer. Real-time PCR was performed with a 7900HT Fast Real-time PCR System (Applied Biosystems, San Francisco, CA, USA) using TransStart Tip Green qPCR SuperMix (TransGene Biotech). Expression was normalized to the expression of GAPDH. The primer sequences used in the experiment were as follows: human IFN-β (forward 5ʹ-AGTGTCAGAAGCTCCTGTGGCAA-3ʹ and 5ʹ-ATGCGGCGTCCTCCTTCTGGA-3ʹ), human hnRNPA2B1 (forward 5ʹ-ATTGATGGGAGAGTAGTTGAGCC-3ʹ and reverse 5ʹ-AATTCCGCCAACAAACAGCTT-3ʹ), human GAPDH (forward 5ʹ-GTCTCCTCTGACTTCAACAGCG-3ʹ and reverse 5ʹ-ACCACCCTGTTGCTGTAGCCAA-3ʹ), mouse IFN-β (forward 5ʹ-AGCTCCAAGAAAGGACGAACA-3ʹ and reverse 5ʹ-GCCCTGTAGGTGAGGTTGAT-3ʹ), and mouse GAPDH (forward 5ʹ-CATCACTGCCACCCAGAAGACTG-3ʹ and reverse 5ʹ-ATGCCAGTGAGCTTCCCGTTCAG-3ʹ).
4
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using Trizol (TransGene Biotech, Beijing, China) and then transcribed into cDNA using TranScript All-in-One First-Strand cDNA Synthesis SuperMix (TransGene Biotech), as instructed by the manufacturer. Real-time PCR was performed with an Eppendorf Realplex PCR system using TransStart Tip Green qPCR SuperMix (TransGene Biotech). The expression was normalized to the expression of the housekeeping gene GAPDH. The primer sequences used in the experiment are shown in Table 1 .
5
Quantifying Cytokine and Transcription Factor Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA is isolated from dorsal skin and ear using TRIzol (Takara, Dalian, China) according to manufacturer’s instruction. For reverse transcription, 500 ng of total RNA was used and cDNA was generated using TranScript All-in-One First-Strand cDNA Synthesis SuperMix (Transgen Biotech, Beijing, China) in a total volume of 20 μl. The mRNA level was determined using 1 μl of cDNA by quantitative real-time PCR (qRT-PCR) with SYBR using a protocol provided by the manufacturer (Takara). The levels of target gene were normalized with respect to GAPDH gene expression. The primer sequences of cytokines and transcription factors are listed as follow (Table 1 ).
Primers for cytokines and T cell-specific transcript factors.
| Forward primer (5′-3′) | Reverse primer (5′-3′) | |
|---|---|---|
| IL-6 | TACCACTTCACAAGTCGGAGGC | CTGCAAGTGCATCATCGTTGTTC |
| IFN-γ | CATCAGCAACAACATAAGCGTCA | CTCCTTTTCCGCTTCCTGA |
| IL-4 | TCG GCA TTT TGA ACG AGG TC | GAA AAG CCC GAA AGA GTC TC |
| IL-17A | CAGACTACCTCAACCGTTCCAC | TCCAGCTTTCCCTCCGCATTGA |
| T-bet | CCACCTGTTGTGGTCCAAGTTC | CCACAAACATCCTGTAATGGCTTG |
| GATA3 | GGGTTCGGAT GTAAGTCG | AGATGTGGCTCAGGGATG |
| RORγt | CCGCTGAGAGGGCTTCAC | TGCAGGAGTAGGCCACATTACA |
| GAPDH | CATCACTGCCACCCAGAAGACTG | ATGCCAGTGAGCTTCCCGTTCAG |
6
Quantifying Mouse Colon Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mouse colon tissue or NCM460 cells using TRIzol reagent (TransGene Biotech, Beijing, China) and transcribed into cDNA using TranScript All-in-One First-Strand cDNA Synthesis SuperMix (TransGene Biotech). Real-time PCR analysis using TransStart Tip Green qPCR SuperMix (TransGene Biotech) was performed on a 7900HT fast real-time PCR system (Applied Biosystems, San Francisco, CA, USA). The target gene expression levels were normalized to the expression of β-actin in the same samples.
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using TRIzol reagent (TransGene Biotech, Beijing, China) and then transcribed into cDNA using TranScript All-in-One First-Strand cDNA Synthesis SuperMix (TransGene Biotech), as instructed by the manufacturer. Real-time PCR was performed with an Eppendorf Realplex PCR system using TransStart Tip Green qPCR SuperMix (TransGene Biotech). The mRNA expression was normalized to the expression of the housekeeping gene β-actin. All primer sequences presented in Table 1
8
Quantifying FZD4 Expression in HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HEK293T cells transfected with WT, mutant, or vector plasmids using TrizolUP (TransGen Biotech, Beijing, China). Subsequently, 1 µg of total RNA was reverse-transcripted into cDNA with TranScript All-in-one First-Strand cDNA Synthesis SuperMix (TransGen Biotech). The cDNA was then amplified and detected with the 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The fold changes of FZD4 were normalized to GAPDH. Primers: GAPDH (Forward: 5′- CTGACTTCAACAGCGACACC-3′ and Reverse: 5′- TGCTGTAGCCAAATTCGTTG-3′) and FZD4 (Forward: 5′- GTCTCAGTCTGGGGTTGCTC-3′ and Reverse: 5′- GTCACGTTGTAGCCGAGGTT-3′).
9
Wheat Leaf RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from wheat leaves using RNA plant extraction kit (Zhuangmeng, Beijing, China), and Transcript® All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China) was used for reverse transcription following the manufacturer’s instruction. Quantitative Real-Time PCR (qRT-PCR) was performed on an Applied Biosystems 7500 Real-Time PCR System with Super Real PreMix Plus (SYBR Green) (TIANGEN, China). The wheat β-actin (GenBank: MF405765.1) was used as an internal control for normalization of the template cDNA. Each experiment was performed with three biological replicates. The quantitative results analysis was performed using the 2–ΔΔCT method (Udvardi et al., 2008 (link)). The primers used for qRT-PCR are listed in Supplementary Table 8 .
10
Quantifying Honey Bee Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNAiso Plus kit (TaKaRa, Dalian, China) was used to extract the total RNA of honey bees according to the explanatory memorandum. Then, single-stranded complementary DNA (cDNA) was synthesized using a Transcript All-in-One First-Strand cDNA Synthesis SuperMix (TransGen Biotech, Beijing, China) at 25 °C for 15 min, 55 °C for 30 min, and then at 85 °C for 5 min. The final products were stored at −20 °C. To measure gene expression, fluorescent qRT-PCR was performed using an SYBR PrimeScript RT-PCR kit (TaKaRa, Dalian, China). Fold changes of genes was calculated using the 2−ΔΔCt method [82 (link)]. The amplification of the actin transcript (Gene ID: LOC108003299) was used as a sample control [83 (link)]. Primers for genes are listed in Table S2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!