Log In Sign up
The largest database of trusted experimental protocols

Pmlm3636

Manufactured by Addgene
Visit Supplier

The PMLM3636 is a general-purpose laboratory equipment. It is designed to perform various tasks in a research laboratory setting. The core function of the PMLM3636 is to provide a versatile and reliable platform for laboratory procedures and experiments.

Automatically generated - may contain errors

Lab products found in correlation

Pjds246, by Addgene (2 mentions) 4d nucleofector ds 137, by Lonza (2 mentions) Mlm3636, by Addgene (1 mentions) Ecori, by New England Biolabs (1 mentions) Plko 1, by Addgene (1 mentions) Prl tk vector, by Promega (1 mentions) Quickchange lightning kit, by Agilent Technologies (1 mentions) Pcmv10 3x flag, by Merck Group (1 mentions)

8 protocols using pmlm3636

1

CRISPR-mediated YY1 Binding Site Deletion

Check if the same lab product or an alternative is used in the 5 most similar protocols
The CRISPR/Cas Nucleases system was used to delete the YY1 binding sites in female mouse ES cells, leaving the CTCF binding site intact. Two target regions were selected: region A positioned upstream of the first YY1 binding site and region B spanning the third site. Positioning the guide RNA target sequence on the site 3 was constrained by the presence of the CTCF site 14 bp downstream. DNA oligonucleotides harboring the sgRNA target sequences were designed using the ZiFiT Targeter program (http://zifit.partners.org/ZiFiT/Disclaimer.aspx). Oligonucleotide pairs were annealed to generate short double-stranded DNA fragments with overhangs compatible with ligation into the BsmBI-digested plasmid pMLM3636. The Cas9 expression plasmid pJDS246 and the sgRNA expression plasmid pMLM3636 were obtained from Addgene (Addgene #43860 and #47754).
Makhlouf M., Ouimette J.F., Oldfield A., Navarro P., Neuillet D, & Rougeulle C. (2014). A prominent and conserved role for YY1 in Xist transcriptional activation. Nature communications, 5, 4878.
+ Open protocol
+ Expand
2

CRISPR sgRNA Design and Cloning

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
Target sequences were entered into the MIT sgRNA design software (http://crispr.mit.edu/), the BROAD sgRNA design tool (http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design-v1) (Doench et al., 2014 (link)), and the sgRNAcas9 tool (version 2.0.10) (Xie et al., 2014 (link)). The intersection of sgRNA target sites produced by all tools was taken for further analysis. sgRNA sequences that failed the BROAD test (score<0.2) were excluded. sgRNA were selected based on high BROAD scores and location relative to other sgRNAs. sgRNA coordinates and sequences are in Tables S1 and S2. Oligonucleotides corresponding to the target sites were annealed and cloned into MLM3636 (Addgene plasmid #43860). For lentivirus plasmids, U6-sgRNA coding sequences were amplified from pMLM3636 by PCR and cloned into an EcoRI and ClaI linearized pLVTHM lentiviral backbone (Addgene plasmid #12247) generating pL-sgRNA1 and pL-sgRNA2 in which GFP is expressed from EF1a promoter.
McDonald J.I., Celik H., Rois L.E., Fishberger G., Fowler T., Rees R., Kramer A., Martens A., Edwards J.R, & Challen G.A. (2016). Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open, 5(6), 866-874.
+ Open protocol
+ Expand
3

Lentiviral vector construction from plasmids

Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmid pMLM3636 (plasmid ID 43860) was obtained from Addgene, cut with BsmBI and a double-stranded DNA fragment, generated by annealing the two oligos MLM3636-1F (5′-ATCTTGTGGAAAGGACGAAACACCGGTTTTAGAGCTAGAAATAGCAAGTT) and MLM3636-1R (5′-AACTTGCTATTTCTAGCTCTAAAACCGGTGTTTCGTCCTTTCCACAAGAT), inserted via Gibson cloning. This yields a modified vector, pgRNA1 containing the U6 promoter, followed by the 5′G of the gRNA sequence and the scaffold sequence, but lacking the targeting sequence. For lentiviral vector construction, the vector pLKO.1 (Addgene plasmid 10878) was modified to insert the gRNA promoter and scaffolding sequence from pgRNA1. The vector was first digested with EcoRI (NEB) and AgeI (NEB). Next, the desired sequences were amplified from pgRNA1 using primers gRNA-PLKO-F (5′-TTTCTTGGGTAGTTTGCAGTTTT) and gRNA-PLKO-R (5′-ccatttgtctcgaggtcgag-TACCTCGAGCGGCCCAAGC) and inserted into pLKO.1. This vector is referred to as pgRNA-pLKO.1.
Köferle A., Worf K., Breunig C., Baumann V., Herrero J., Wiesbeck M., Hutter L.H., Götz M., Fuchs C., Beck S, & Stricker S.H. (2016). CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics, 17, 917.
+ Open protocol
+ Expand
4

Generating Engineered MM.1S-CG and ΔCS1-MM.1S-CG Cell Lines

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
MM.1 S cells, kindly provided by Leif Bergsagel, were modified to MM.1S-CG [16 (link)]. ΔCS1-MM.1S-CGs were generated using the CS1 guide sequence above cloned into pMLM3636 (Addgene) lentiviral vector. MM1.S-CG cells were transduced with 1ug gRNA plasmid, 250 ng Cas9-HF plasmid and electroporated in SF solution using the Lonza 4D Nucleofector DS-137 program. CS1 negative cells were sorted using a MoFlow. OPM2 cells (DMSZ, Germany) were modified to express CBR-GFP as above.
O’Neal J., Ritchey J.K., Cooper M.L., Niswonger J., Sofía González L., Street E., Rettig M.P., Gladney S.W., Gehrs L., Abboud R., Prior J.L., Haas G.J., Jayasinghe R.G., Ding L., Ghobadi A., Vij R, & DiPersio J.F. (2022). CS1 CAR-T targeting the distal domain of CS1 (SLAMF7) shows efficacy in high tumor burden myeloma model despite fratricide of CD8+CS1 expressing CAR-T cells. Leukemia, 36(6), 1625-1634.
+ Open protocol
+ Expand
5

Generating CS1-Deficient MM.1S Multiple Myeloma Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
MM.1S cells, kindly provided by Leif Bergsagel, were modified to MM.1S-CG (16 (link)). ΔCS1-MM.1S-CGs were generated using the CS1 guide sequence above cloned into pMLM3636 (Addgene) lentiviral vector. MM1.S-CG cells were transduced with 1ug gRNA plasmid, 250ng Cas9-HF plasmid and electroporated in SF solution using the Lonza 4D Nucleofector DS-137 program. CS1 negative cells were sorted using a MoFlow. OPM2 cells (DMSZ, Germany) were modified to express CBR-GFP as above.
O’Neal J., Ritchey J.K., Cooper M.L., Niswonger J., Sofía González L., Street E., Rettig M.P., Gladney S.W., Gehrs L., Abboud R., Prior J.L., Haas G.J., Jayasinghe R.G., Ding L., Ghobadi A., Vij R, & DiPersio J.F. (2022). CS1 CAR-T targeting the distal domain of CS1 (SLAMF7) shows efficacy in high tumor burden myeloma model despite fratricide of CD8+CS1 expressing CAR-T cells. Leukemia, 36(6), 1625-1634.
+ Open protocol
+ Expand
6

Designing gRNAs for CRISPR-Cas9 Targeting HBB

Check if the same lab product or an alternative is used in the 5 most similar protocols
A list of gRNAs directing spCas9 were designed to target the human HBB locus requiring a NGG PAM. Potential gRNAs were aligned towards the human genome sequence to identify potential off-target sites with number of mismatches and indels. Variations in PAM sequence (NGG or NAG) were allowed for gRNAs with spacer lengths of 20 nucleotides. The target sequences are listed in Supplementary Table 2. Primers containing gRNA sequences were ordered using Integrated DNA Technologies. gRNAs 8, 15, 19 and 21 were generated by cloning annealed gRNA sequence oligos containing the target sequence into pMLM3636 (Addgene plasmid #43860), which contains a SpCas9-TRACR and a customizable U6-driven gRNA scaffold. The clones were maxi prepped and sequence confirmed by Sanger sequencing. gRNAs 8, 15, 11 and 32 for Fig. 4 and gRNAs 333, 334 and 335 for Supplementary Fig. 6 were generated by PCR and transfected as amplicons containing the U6 promoter, spacer sequence, and TRACR.
Bothmer A., Phadke T., Barrera L.A., Margulies C.M., Lee C.S., Buquicchio F., Moss S., Abdulkerim H.S., Selleck W., Jayaram H., Myer V.E, & Cotta-Ramusino C. (2017). Characterization of the interplay between DNA repair and CRISPR/Cas9-induced DNA lesions at an endogenous locus. Nature Communications, 8, 13905.
+ Open protocol
+ Expand
7

CRISPR-mediated YY1 Binding Site Deletion

Check if the same lab product or an alternative is used in the 5 most similar protocols
The CRISPR/Cas Nucleases system was used to delete the YY1 binding sites in female mouse ES cells, leaving the CTCF binding site intact. Two target regions were selected: region A positioned upstream of the first YY1 binding site and region B spanning the third site. Positioning the guide RNA target sequence on the site 3 was constrained by the presence of the CTCF site 14 bp downstream. DNA oligonucleotides harboring the sgRNA target sequences were designed using the ZiFiT Targeter program (http://zifit.partners.org/ZiFiT/Disclaimer.aspx). Oligonucleotide pairs were annealed to generate short double-stranded DNA fragments with overhangs compatible with ligation into the BsmBI-digested plasmid pMLM3636. The Cas9 expression plasmid pJDS246 and the sgRNA expression plasmid pMLM3636 were obtained from Addgene (Addgene #43860 and #47754).
Makhlouf M., Ouimette J.F., Oldfield A., Navarro P., Neuillet D, & Rougeulle C. (2014). A prominent and conserved role for YY1 in Xist transcriptional activation. Nature communications, 5, 4878.
+ Open protocol
+ Expand
8

Generating Engineered Cell Lines for CRISPR Research

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
U2OS human osteosarcoma, HEK-293 human embryonic kidney, and NCI-H460 human non-small cell lung carcinoma cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM) (U2OS and HEK-293) or RPMI (NCI-H460) medium containing 10% fetal bovine serum, 100 U/ml penicillin and 100 μg/ml streptomycin at 37 °C in 5% CO2. The pMLM3636 expression vector for Streptococcus pyogenes Cas9 sgRNA was a gift from JK Joung laboratory (Addgene plasmid # 43860). The Cas9D10A expression vector was a gift from G Church (Addgene plasmid #41816) (19 (link)), the CAGA12-Luc plasmid was described in (20 (link)), and the Renilla expression vector pRL-TK vector is from Promega. The pCMV10-3xFlag-RNF111-WT (Flag-RNF111-WT) expression vector was generated by PCR subcloning of human RNF111 cDNA (corresponding to isoform 3) from PcDNA4/TO-SFS-RNF111 (11 (link)) in pCMV10-3xFlag (Sigma). The pCMV-3xHA-SKIL-WT (HA-SKIL-WT) expression vector was generated by PCR subcloning of human SKIL cDNA form PCMV5B-HA-SnoN (21 (link)) in PCMV-3xHA. pCMV10-3xFlag-RNF111-C933A (Flag-RNF111-C933A) and pCMV-3xHA-SKIL-342/43-KR (HA-SKIL-342/43-KR) mutants were generated by site-directed mutagenesis respectively on pCMV10-3xFlag-RNF111-WT and pCMV-3xHA-SKIL-WT by using the QuickChange Lightning kit (Agilent).
Laigle V., Dingli F., Amhaz S., Perron T., Chouchène M., Colasse S., Petit I., Poullet P., Loew D., Prunier C, & Levy L. (2021). Quantitative Ubiquitylome Analysis Reveals the Specificity of RNF111/Arkadia E3 Ubiquitin Ligase for its Degradative Substrates SKI and SKIL/SnoN in TGF-β Signaling Pathway. Molecular & Cellular Proteomics : MCP, 20, 100173.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!