Geneamp pcr system 7500

A two-step reaction process was used for quantification reverse transcription (RT) and PCR. Each RT reaction consisted of 0.5 μg RNA, 2 μL of Primer Script Buffer, 0.5 μL of oligo dT, 0.5 μL of random 6 mers and 0.5 μL of Primer Script RT Enzyme Mix I (TaKaRa, Japan), in a total volume of 10 μL. Reactions were performed in a GeneAmp^® PCR System 7500 (Applied Biosystems) for 15 min at 37 °C, followed by heat inactivation of RT for 5 s at 85 °C. The 10 μL RT reaction mix was then diluted 10-fold in nuclease-free water and held at −20 °C. At the end of the PCR cycles, melting curve analysis was performed to validate the specific generation of the expected PCR product. All experiments were done in triplicate. The expression levels of lncRNAs were normalized to glyceraldehyde-3-phosphate dehydrogenase and were calculated using the 2-ΔΔCt method. The primer sequences were designed in the laboratory based on the DNA sequences and is shown in Table S2.

To verify the results of microarray data, 6 differentially expressed lncRNAs were selected randomly for RT-PCR, including 3 upregulated lncRNAs (HNRNPU-AS1, AC005786.7, and LINC00861) and 3 downregulated circRNAs (RP11-443B7.3, CTD-2616J11.14, and CTD-2616J11.3). Briefly, a total of 3 μg RNA was used for reverse transcription. Detection of the amplified cDNA was performed with the rotor gene Q series (Qiagen, USA). The GeneAmp PCR System 7500 (Applied Biosystems, USA) was used for RT-PCR. 1 μl of cDNAs was added to 12.5 μl of SYBR Green Gene Expression Master Mix (Applied Biosystems, Inc.), 10.5 μl of DEPC-treated water, and 0.5 μl of primers. The relative expression levels of the genes were presented as fold changes and normalized to the housekeeping gene GAPDH. The results were analyzed according to the 2^−ΔΔCt method [14 (link)]. Primers used for RT-PCR are listed in Table 2.

A two-step reaction process was used for quantification reverse transcription [21 (link)] and PCR. Each RT reaction consisted of 0.5 μg RNA, 2 μL of Primer Script Buffer, 0.5 μL of oligo dT, 0.5 μL of random 6 mers, 0.5 μL of Primer Script RT Enzyme Mix I (TaKaRa, Japan) and nuclease-free water to reach a volume of 10 μL. Reactions were performed in the GeneAmp^® PCR System 7500 (Applied Biosystems, USA) for 15 min at 37°C, then inactivation of RT by heating at 85°C for 5 s. Then the RT mix was diluted by 10-fold with nuclease-free water and stored at −20°C. While running real-time quantitative PCR, melting curve was analyzed to verify the specificity of the aimed PCR product. All experiments were done in triplicate. Glyceraldehyde-3-phosphate dehydrogenase was used as an endogenous control to normalize and using the 2-ΔΔCt method for lncRNAs expression calculation. The primer sequences were designed in the laboratory based on the DNA sequences and is shown: NONHSAG007503 (forwards primer GGAGAAGTCTGCCGTTAC; reverse primer TCAAAGAACCTCTGGGTCC) and NONHSAT040387 (forwards primer CTTCAGTAGCTCTGCTATGC; reverse primer AGAGTCTGCGTAGTATATGGTA).