The largest database of trusted experimental protocols

Pcmv6 xl5 empty plasmid

Manufactured by OriGene

PCMV6-XL5 is an empty plasmid vector designed for cloning and expression in mammalian cells. The plasmid contains a CMV promoter for high-level expression of the inserted gene, and the XL5 backbone for stable maintenance in host cells.

Automatically generated - may contain errors

2 protocols using pcmv6 xl5 empty plasmid

1

Construction of TNBC Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
pCMV6-E2F1, pCMV6-c-myc, and pCMV6-XL5 empty plasmid was purchased from Origene (Rockville, MD). MiR-301a hairpin antagomirs were obtained from GeneCopoeia Inc. (Guangzhou, China). All transfections were conducted using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen). miR-301a-expressing retroviruses, Cip2a-expressing retroviruses were purchased from GENECHEM (Shanghai, China). The Cip2a short hairpin RNA (shRNA) lentivirus vectors were generated by GeneCopoeia Inc. (Guangzhou, China). The target sequences of Cip2a shRNA was 5'-CUGUGGUUGUGUUUGCACUTT-3'. For selection of TNBC stable cell lines, retroviruses were transduced into BT549 and MDA-MB-231 cells in the presence of polybrene (6 μg/mL, Sigma). Cells were selected with 1 μg/mL puromycin for 7 days.
+ Open protocol
+ Expand
2

Lentiviral Manipulation of ALKBH5 and FOXO1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lentiviral vectors expressing nontargeting pLKO.1 control shRNA (SCH002), two shRNA constructs targeting ALKBH5-shRNA1 (TRCN0000064783) and -shRNA2 (TRCN0000064787) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Short hairpin sequences against either the FOXO1 or the scrambled short hairpin RNA (shRNA) sequences were cloned into the GFP-labeled lentiviral vector GV102 (GENECHEM). The target sequences selected are: shControl, TTCTCCGAACGTGTCACGT; shFOXO1-1, CAGTCTGTCCGAGATCAGTAA; shFOXO1-2, AGCGGGCTGGAAGAATTCAAT. Expression plasmid for pCMV6-SOD2 (Cat. No RC202330), and pCMV6-XL5 empty plasmid was purchased from Origene (Rockville, MD). For cell transfection, Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA) was used according to the manufacturer's instructions. After 72 h transfection, stably expressing or knockdown cells were selected in RPMI 1640 medium containing 1 μg/mL puromycin.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!