The largest database of trusted experimental protocols

Lightcycler 96 pcr system

Manufactured by Takara Bio

The LightCycler® 96 PCR system is a real-time PCR instrument designed for quantitative and qualitative analysis of nucleic acid samples. It is capable of performing high-throughput, high-precision gene expression analysis and genetic variation detection.

Automatically generated - may contain errors

2 protocols using lightcycler 96 pcr system

1

Quantifying Gene Expression in hESCs

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using the Trizol reagent (MRC, TR1187) and cDNA was converted from 1μg total RNA using the ReverTraAce Kit (TOYOBO, 34520B1). The qPCR reactions were done on Roche LightCycler® 96 PCR system with the SYBR Premix Ex Taq™ Kit (TAKARA, RR420A). Gene expression levels were normalized to GAPDH and compared to gene expression levels in hESCs. Three or more biological replicates were performed for each assay and data bars represent mean ± SD. Primers used in this study are listed in Table S1.
+ Open protocol
+ Expand
2

Quantification of Intestinal Tight Junction Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the ileum using TRIzol Reagent, and reverse transcription was performed using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China). Quantitative real-time PCR was performed using TB Green Premix Ex Taq II (Takara) by a Light Cycler 96 PCR System to examine the mRNA levels. Relative RT-PCR was performed to measure gene expression of Claudin-2, Occludin, and Zo-1mRNAs. The primers used were shown in Table 2. Relative quantification of gene expression was determined by 2−ΔΔCt.

Primer sequences of target and reference genes.

Table 2
Gene namePrimer sequence (5′–3′)
Claudin-2F: CATACTCCTGGGTCTGGTTGGT
R: GACAGCCATCCGCATCTTCT
OccludinF: ACGGCACCTACCTCAA
R: GGGCGAAGAAGCAGATGAG
Zo-1F: CAACGTAGTTCTGGCATTATTCG
R: GGAGGATGCTGTTGTCTCGG
β-actinF: AGTGTCTTTTTGTATCTTCCGCC
R: CCACATACTGGCACTTTACTCCTA
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!