Step onetm real time pcr system thermal cycling block

SW480 cells were seeded in 12-well plates at 300,000 cells/well. After 24 h, the cells were treated with scrambled-siRNA TNVs and DDHD1-siRNA TNVs (25 μg of TNVs loaded with 200 pmol of scrambled or DDHD1-siRNA) and with respective supernatants collected after TNVs electroporation for 24 and 48 h. At the end of the treatments, the total RNA was extracted using an Illustra^TM RNA spin mini-RNA isolation kit according to the manufacturer’s instructions (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The RNA was reverse-transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). Then, RT-QPCR was performed in 48-well plates using a Step OneTM Real-time PCR System Thermal Cycling Block (Applied Biosystem). The sequences of the primers used for quantitative SYBR^®Green real-time PCR were as Table 2:
Target transcript levels were normalized against the endogenous control GAPDH consistently expressed in all samples (ΔCt). For each condition, final values were expressed as the DDHD1 level normalized to the endogenous control (2^{^−ΔCT}).

HDFα cells were seeded in 12 well-plates at 2×10⁴ cells/well; 24h post-seeding cells were treated with 10 or 25 μg/ml of LNVs for 24h. At the end of the treatments, total RNA was extracted using Illustra^TM RNA spin mini-RNA isolation Kit (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). Then, the cDNA was subjected to quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. The sequences of the primers used were listed in below table.

Gene	Forward Sequence (5′to 3′)	Reverse Sequence (5′to 3′)
ACT	TCCCTTGCCATCCTAAAAAGCCACCC	CTGGGCCATTCTTCCTTAGAGAGAAG
COL1α1	TGTGGATGCCTCTTGGGTATC	TTTTGGCCATCTCTTCCTTCA
HAS2	GTCATGTACACAGCCTTCAGAGC	ACAGATGAGGCTGGGTCAAGCA
COX-2	CGGTGAAACTCTGGCTAGACAG	GCAAACCGTAGATGCTCAGGGA

Real-time PCR was performed using Step One^TM Real-time PCR System Thermal Cycling Block (Applied Biosystem) in a 20 μl reaction containing 300 nM of each primer, 2 μl template cDNA, 18 μl 2X SYBR Green I Master Mix. The PCR was run at 95°C for 20 sec followed by 40 cycles of 95°C for 3 sec and 60°C for 30 sec. Actin was used as the endogenous control. Relative changes in gene expression between control and treated samples were determined using the ΔΔCt method.

The THP-1 cells were seeded in 12 well-plates at 1 × 10⁵ cells/mL and differentiated in M0 macrophages, as described above; the cells were then treated with MM1.S (50 µg/mL) and SW480 (20 µg/mL)-derived SEVs for 6 and 24 h. At the end of the treatments, total RNA was extracted using Illustra^TM RNA spin mini-RNA isolation Kit (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). Then, the cDNA was subjected to quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. The sequences of the primers used were indicated in Table 1:
Real-time PCR was performed using Step OneTM Real-time PCR System Thermal Cycling Block (Applied Biosystem, Waltham, MA, USA) in a 20 μL reaction containing 300 nM of each primer, 2 μL of template cDNA, and 18 μL of 2X SYBR Green I Master Mix. The PCR was run at 95 °C for 20 s followed by 40 cycles of 95 °C for 3 s and 60 °C for 30 s. GAPDH was used as the endogenous control. Relative changes in gene expression between control and treated samples were determined using the ΔΔCt method.