S220 focused ultrasonicator

TT-seq was performed as described (27 (link),31 (link)), with minor changes. Specifically, 6 × 10⁷ cells, grown in absence of penicillin and streptomycin, from two biological replicates were treated for 15 and 30 min with solvent (DMSO) or 7.5μM 1-NM-PP1 (NM) at 37°C and 5% CO₂. For the 15 min treatment, cells were exposed to 10 min 500 μM of 4-thiouracil (4sU, Carbosynth, NT06186) after 5 min of DMSO or NM treatment (15 min total treatment). For the 30 min treatment, cells were exposed to 10 min 500 μM of 4-thiouracil (4sU, Carbosynth, NT06186) after 20 min of DMSO or NM treatment (30 min total treatment). Cells were lysed in 5 ml of QIAzol (Qiagen) and 300 ng of RNA spike-ins mix were added to each sample. RNA spike-ins were produced as described (27 (link)). RNAs were sonicated to obtain fragments of <10 kb using AFAmicro tubes in a S220 Focused-ultrasonicator (Covaris Inc, parameters: 10 s, peak power 100, cycles 200, duty cycle 1%). 4sU-labeled RNAs were purified from 240 μg of each of the fragmented RNAs. Biotinylation and purification of 4sU-labeled RNAs was performed as described (27 (link),32 (link)). 100 ng of input RNA was used for strand-specific library preparation according to the Ovation Universal RNA-seq System (NuGEN). Libraries were prepared using random hexamer priming only.

The genomic DNA of two chalcidids was qualified for next generation sequencing and was fragmented to 350 bp by a Covaris S220 Focused Ultrasonicator (Covaris, MA, USA). The sequence libraries were constructed using TruSeq DNA LT Sample Preparation Kit (Illumina, Inc., San Diego, CA, USA). After repairing the blunt ends, adenylating 3′ ends and ligating adapters, the fragmented DNA was enriched. Then, both libraries were pooled and sequenced using an Illumina Hiseq X10 platform. The obtained raw reads were filtered by removing adaptor sequences, contamination, and low-quality reads.

3C libraries were sonicated to 200 bp fragments using a Covaris S220 Focused Ultrasonicator with the following settings: six cycles of 60 s; duty cycle, 10%; intensity, 5; cycles per burst, 200 (Supplementary Figure S2a). Illumina TruSeq adapters were subsequently added using the NEBNext Ultra DNA Library Prep kit according to the manufacturer's protocol. DNA clean up steps were performed with Ampure XP beads at a 1:1.8 ratio to minimize loss of material. The libraries were indexed and amplified in nine rounds of PCR amplification using the Herculase II PCR kit (Supplementary Figure S2b). 700 ng–1.5 μg of adaptor-ligated material was used for the oligonucleotide capture steps, which were performed as previously described, using oligonucleotides targeting the murine Hba-a1, Hba-a2, Hbb-b1, Hbb-b2 and Slc25a37 promoters (8 ).

HeLa cells were exposed to 200 µM SNOC and then incubated for the indicated times, or transduced with NOS2 for 48 h using Lipofectamine 3000. Subsequently, genomic DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega). Genomic DNA (1 µg) was fragmented to a peak size of 155–170 bp with a Covaris S220 focused ultrasonicator (Covaris, Inc., Woburn, MA, USA). Targeted bisulfite sequencing libraries were prepared using the TruSeq Methyl Capture EPIC Library Prep kit (Illumina) according to the manufacturer’s protocol, followed by 101 bp paired-end sequencing on a NextSeq550 system (Illumina). Analysis of methylation sites was performed using MethylSeq v2.0.0, which employed Bismark for methyl calling and aligned to the reference human genome (hg19) using Bowtie2. The ratio of the number of sequenced methylated cytosine reads to the total number of reads for each locus was evaluated. We only considered cytosine sites in targeted regions of Illumina-optimized capture probes with at least ≥10 reads and were measured in every sample. The sequence data files have been deposited in the DNA Data Bank of Japan (https://ddbj.nig.ac.jp/resource/sra-submission/DRA012330).

Helicobacter pylori JP26 genomic DNA was kindly provided by Dr. Gang Fang’s lab (Icahn School of Medicine at Mount Sinai). E. coli genomic DNA was isolated using DNeasy Blood and Tissue Kit according to the manufacturer’s instructions (Qiagen, 69506). Microbial community standard DNA was purchased from Zymo Research (D6306). One microgram of genomic DNA was first fragmentized to 100–300 bp using Covaris S220 Focused-ultrasonicator. Fragmented gDNA was ligated to TruSeq adaptor using NEBNext Ultra™ II DNA Library Prep Kit for Illumina (NEB, E7645S). Unmodified control DNA was made by amplifying adaptor-ligated DNA using Q5 DNA polymerase (NEB, M0492S). Both native and amplified DNA was first annealed to excessive protective adaptor sequences in 5 mM adaptor oligos (F-RC: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT, R: CTGGAGTTCAGACGTGTGCTCTTCCGATCT) and 0.2 M NaCl (95 °C for 2 min and hold at 37 °C with ramp rate for temperature decreasing at 1 °C/s) and then treated by 1 M NaNO₂ and 2.3% (v/v) AcOH at 37 °C for 4 h. Nitrite-treated DNA was purified using Oligo Clean & Concentrator Kits (Zymo Research, D4060). The indexed library was constructed using Taq DNA polymerase (NEB, M0490S) (cycle number was determined by qPCR with (BioRad, 1725121)). Samples were sequenced using NextSeq 500.