No 17721 1 ap

ChIP assays were performed with the SimpleChIP^® Enzymatic Chromatin IP Kit (Cell Signaling Technology, USA) as previously described [17 , 23 ]. Chromatin samples were immunoprecipitated with antibodies against a negative control normal IgG, p65 (ab32536, Abcam), anti-RNA polymerase II (ab264350, Abcam) or DHX9 (No.17721–1-AP, Proteintech), respectively. Then, IP production was performed with RT-qPCR. For the ChIP-re-ChIP experiments, the supernatant containing anti-DHX9, p65, or RNA polymerase II antibody-immunoprecipitated cross-linked protein-DNA complexes was further immunoprecipitated with magnetic beads coated anti-p65, DHX9, or RNA polymerase II antibody. Then, the immunoprecipitated DNA was purified for quantitative PCR analyses. The primers of IL-6 promoter were as following F: AGACCAGTGATTTTCACCAGG, R: TGGCATGAGCTGAGGGTTATTGC.

THP-1-derived macrophages were transfected with control siRNA (si-NC) or si-DHX9 for 48 h before exposure to 50 μg/mL DiI-ox-LDL (20609ES76, YEASEN) for 30 min at 37 °C. Then, the cells were fixed, permeabilized, and stained with primary antibodies against DHX9 (No.17721–1-AP, Proteintech), followed by staining with the second antibodies. Cellular nuclei were stained with DAPI (0.5 μg/ml, Cell signaling) and then imaged by a Carl Zeiss LSM 800 confocal.

Co-IP was performed as previously described [17 , 23 ]. Protein samples were immunoprecipitated with antibodies against DHX9 (No.17721–1-AP, Proteintech). Then, IP production was performed with Western blotting.