Superdex 75 16 600 sec column

Oligonucleotide purification was achieved using SEC as detailed previously (33 (link)). Briefly, oligonucleotides were annealed at concentrations of 40–100 μM in their respective buffers, filtered through 0.2 μm filters, and injected onto an equilibrated Superdex 75 16/600 SEC column (GE Healthcare 28-9893-33) using a Waters 600 HPLC system. The flow rate was maintained at 0.5 ml/min and sample fractions were collected every 2 min from 100 to 180 min run time. The molecular weights of fractionated species were estimated based on a regression analysis of elution time versus log(MW) of protein standards (Sigma #69385), with elution profiles monitored at 260 and 280 nm. Purifications were carried out at room temperature and fractionated samples were stored at 4°C prior to concentration and downstream analysis.

DNA oligonucleotides were purchased from IDT (Coralville, IA). The DGD construct was prepared in the following way. First, the 46 nt G-quadruplex strand (5’- CTATGTATACAAAGAGGGTGGGTAGGGTGGGTTTAATGCGGCACGC) was diluted to 10 μM in 100 mL of BPEK buffer (8 mM sodium phosphate buffer supplemented with 185 mM KCl, pH 7.2, with 1 mM sodium EDTA to inhibit DNase). The sample was then heated to 99.9°C for 20 min before slow cooling overnight in a 2 L water bath. The sample was then concentrated to approximately 1 mM and mixed with the 46 nt surrogate-complement strand (5’- GCGTGCCGCATTAATTTTTTTTTTTTTTTTTTTTTTGTATACATAG) at a 1:1 ratio. The sample was then incubated overnight at 4°C to allow for annealing of the duplex regions. The sample was subsequently filtered through 0.2 μm filters and purified by size-exclusion chromatography (SEC) using a Superdex 75 16/600 SEC column (GE Healthcare 28-9893-33) running at 0.5 ml/min with fractions collected every 2 min. The purified aliquots were then concentrated with Pierce protein concentrators (ThermoFisher, #88515) and stored at 4°C until use.