Primer probes

Cells were grown in 60 mm² dishes, and total RNA was extracted with Trizol reagent (ThermoFisher, Carlsbad, CA, USA), according to the manufacturer’s instructions. One microgram of total RNA was reversely transcribed into cDNA via the SuperScript III system (ThermoFisher, Carlsbad, CA, USA), and 0.5 µL of cDNA was used per RT-qPCR reaction with Power SYBR Green (ThermoFisher, Carlsbad, CA, USA) master mix. Reactions were read in 7500 StepOne Plus from the Oswaldo Cruz Institute. Primer sequences for Drp1, Fis1, ZO-1, claudin-5, HIF-1α, Mfn2, MFF, and TOMM20 are provided in Table S1. For the E gene and Spike1 RT-qPCR, we used the protocols described in [45 (link)] and [46 (link)], respectively. For the remaining genes, 100 ng of total RNA was used for Taqman reactions using primer probes from ThermoFisher (Carlsbad, CA, USA): Hs00242739_m1 (LTB); Hs00174128_m1 (TNF); Hs00232399_m1 (RELB); Hs00357891_s1 (JUNB); Hs00759776_s1 (FOSL1); Hs00765730_m1 (NFKB1); Hs00174103_m1 (CXCL8); Hs00601975_m1 (CXCL2); Hs00236937_m1 (CXCL1); Hs00173615_m1 (PTX3); Hs00174961_m1 (EDN1); Hs00299953_m1 (SERPINE2); and Hs01028889_g1 (NFKB2). GAPDH (Hs02786624_g1) was used for sample normalization. Gene expression variations were assessed by the 2^ΔΔCt method, with Ct as the cycle number at the threshold. Desired PCR result specificity was determined based on melting curve evaluation.

To validate data from the RNA-seq, qPCR was performed using primer/probes from Applied Biosystems (Foster City, CA, USA), similar to methods described previously [10 (link),26 ]. Small nucleolar RNA MBII-202 (sno202) transcript was used for normalization of miRs loading, and hypoxanthine-guanine phosphoribosyltransferase-1 (Hprt-1) was used for normalization of mRNA loading. The 2^−ΔΔCt method was used to calculate fold changes as described previously [27 (link),28 (link)].

cDNA synthesis was performed using MMLV reverse transcriptase (Promega) and 500 ng of RNA. Gene transcripts were quantified using the Corbett Research Rotorgene 3000 or 6000 thermocyclers with TaqMan primer probes (Applied Biosystems) or custom primers. Quantification of CD80, CXCL10, IFNLR1, and TRAIL were performed using primer probes (Applied Biosystems). Custom primers sets are as follows: CCL2 (CTGCTCATAGCAGCCACCTT, GCACTGAGATCTTCCTATTGGTG), CCL8 (TCCCAAGGAAGCTGTGATCTT, ATGGAATCCCTGACCCATCT), IFNAR1 (TCAGGTGTAGAAGAAAGGATTGAAA, AGACACCAATTTTCCATGACGTA), IFNL1 (AGGGACGCCTTGGAAGAGT, GAAGCCTCAGGTCCCAATTC), IFNL2/3 (GCCACATAGCCCAGTTCAAGTC, GGCATCTTTGGCCCTAAA) IL1B (TCGCCAGTGAAATGATGGCT, GGTCGGAGATTCGTAGCTGG), IL15 (GTGATGTTCACCCCAGTTGC, CATCTCCGGACTCAAGTGAAA), ISG15 (CGCAGATCACCCAGAAGATC, GCCCTTGTTATTCCTCACCA), TNFα (CCCGAGTGACAAGCCTGTAG, TGAGGTACAGGCCCTCTGAT), and viperin (CTTTTGCTGGGAAGCTCTTG, CAGCTGCTGCTTTCTCCTCT). All transcripts were normalized to 18s ribosomal RNA (Applied Biosystems, 4319413E). Standard curves derived from combined assay RNA were used to determine relative expression of genes.

High-glucose Dulbecco’s Modified Eagle Medium (DMEM) and fetal bovine serum (FBS) were purchased from Invitrogen (Waltham, MA, USA); Trizol was purchased from Life Technologies (Carlsbad, CA, USA); primer probes, high-capacity reverse transcription kit, and real-time polymerase chain reaction (RT-PCR) reagents were from Applied Biosystems by Thermo Fisher Scientific, Carlsbad, CA, USA. HDGF siRNA, sc-45878, was obtained from Santa Cruz Biotechnology, Dallas, TX, USA. Control siRNA (sc-37007, Santa Cruz, Dallas, TX, USA). Primary antibodies used: (a) mouse monoclonal: Anti-β-Actin Antibody (C4): sc-47778 (Santa Cruz Biotechnology, Dallas, TX, USA); (b) rabbit monoclonal and polyclonal: Anti-HDGF (E3P7K): 42105 (Cell Signaling Technology, Danvers, MA, USA).