T4 dna ligase

For the heterologus gene expression analysis, the 5′ UTR regions of Tdc gene from the two C. roseus accessions Kew1 and Prabal were amplified with UTR specific primer pairs which were designed in such a manner that 5′ end of forward primer had Xba1 restriction site whereas the 5′ end of reverse primer had Xma1 restriction site (F: 5′-GCTCTAGAACAGCACAGCAACTTCCTCA and R: 5′-CCCCCGGGTGTGAATCAATGCTGCCCATTA). The PCR amplicon and the pBI121 plant expression vector were double digested with respective enzymes (NEB) followed by purification and ligation using T4 DNA ligase (Clontech). Recombinant and control pBI121 vector was transformed into competent E. coli cells (NEB-10 beta) and confirmed by sequencing using CaM35S forward primer and GusA reverse primers. Further, plasmid DNA was transformed into the competent GV3101 agrobacterium strain and selected on media containing 50 μg/ml kanamycin and 30 μg/ml rifampicin.

The reporter gene vector containing the PTCH1 3′ UTR was custom ordered from Origene Technologies (Rockville, MD). The sequence was ligated in pMirTarget, upstream of the RFP and luciferase genes and designated, pPTCH-UTR-JM. A mutant form of pPTCH-UTR-JM was generated by deleting the miR-9 binding site within the 3′ UTR, designated pPTCH-UTRΔ-JM. The deletion was achieved with the Expand Long Template PCR System (Roche, Indianapolis, IN) and the following primers: Forward, 5′-ACG CGT AAC CTT TGG GGG GTG G-3′ and Reverse, 5′-CGC CGG CGC CCT CAT TAT TAG GCA TC-3′. The primers were synethesized with the sequences for Sgf1 and Mlu1 (New England Biolabs, Ipswich, MA). Direct insertion of the amplified fragment was placed into pMirTarget using T4 DNA ligase (Clontech, Mountain View, CA). The deletion of the miR-9 site was confirmed by DNA sequencing at Genewiz (South Plainfield, NJ).
pCMV-miR co-expressing miR-9-2 and GFP, was purchased from Origene Technologies and then stably transfected in U87 and T98G cells with Effectene (Qiagen, Valencia, CA). The stable transfectants were selected with 200 μg/mL of G148 (Invitrogen/Life Technologies).

GeneArt^® Site‐Directed Mutagenesis System (Cat No. A13282, Invitrogen) was used to introduce total eight mutations in the motifs (MYB1AT, MYBCORE, MYBST1, MYC AT RD22, HEXMOTIF, L1BOX, MYC CONSENSUS and MYCATRD22) of P_GhGDSL at loci –603/–598, –600/–594, –558/–553, –450/–445, –418/–413, –226/–219, –67/–62 and –11/–6. The mutagenic forward and reverse primers (Table S5) were synthesized (Applied Biosystems, Fostercity, CA, USA) following the instructions (Invitrogen, Carlsbad CA, USA) and used to generate the mutagenic construct by PCR. The mutation constructs (sdm) were confirmed by a 96 capillary automated sequencer (ABI 3730 DNA Analyzer) using a vector specific T3 forward primer (5′‐AATTAACCCTCAC TAAAGGG‐3′) and a T7 reverse primer (5′‐GTAATACGACTCAC TATAGGGC‐3′). The confirmed plasmids were digested with restriction enzymes (SalI‐BamHI) and ligated into the plasmid pBI101 (Clontech, Terra Bella, CA, USA) using T4 DNA ligase (NEB). The mutagenic constructs were named as sdm1 to sdm8. All the constructs were transformed in cotton by embryo transformation method (Kumar et al., 2013). The forward primer 5′‐ATGATTGAACAAGATGGATTGCACG‐3′ (Npt–2 forward primer) and reverse primer 5′‐TCAGAAGAACTCGTCAAGAAGGC‐3′ (Npt–2 reverse primer) were used to confirm the positive transgenic cotton lines by PCR (Figure S5).

Genomic DNA was extracted from H1688 cells, and MMP-9, MMP-16, Sp1 and p65 were amplified by PCR using primer sequences shown in Additional file
1: Table S1. The PCR DNA fragments were extracted by a Gel Extraction kit (Invitrogen, USA). The PCR fragments and pGL3-basic luciferase reporter vector (Promega, USA) were digested with FastDigest SacI, NheI or XhoI (Thermo, USA), extracted and ligated with T4 DNA Ligase (TakaRa, Japan) to generate the four luciferase reporter constructs. The binding site mutants were constructed by overlap PCR and nested PCR, and the primers were listed in Additional file
1: Table S1. The constructs were confirmed through sequencing by BioSune Company.

Stable gene silencing was carried out according to the description of Wang et al. (2015 (link)). Short hairpin RNA sequences targeting the coding regions of mRNAs were obtained from Shanghai Generay Biotech Co., Ltd. (Shanghai, China) (Table S1). The annealed oligonucleotides were ligated to the BamHI and SphI (TaKaRa, Japan) double-digested pACYC184 vector with T4 DNA ligase (TaKaRa, Japan). Recombinant plasmids were then transformed into P. plecoglossicida by electroporation. An empty pACYC184 vector was used as a control. Stable silenced clones were screened by chloramphenicol (34 μg/ml).

Details of the cloning steps, as well as the source plasmids, primers and oligonucleotides, plasmids for Cas9 fusions and the multi-guide system are given in the Supplementary Data. If applicable, plasmids are referenced by the number at the Addgene repository, where full sequence information is available. Assembly was done with 50 ng of the backbone plasmid pBackBone-BZ and each selected module vector, using molar ratio of 3:1 (module:backbone). Reaction was done in 1× CutSmart Buffer (New England Biolabs, Ipswich, MA, USA, NEB) with additional 1 mM ATP (NEB), 10 U of BsaI (NEB) and 350 U of T4 DNA Ligase (TaKaRa, Kusatsu, Shiga, Japan) with 30 cycles of 5 min at 37°C followed by 10 min at 16°C, after which ligase was inactivated at 50°C for 10 min. Next, BsaI was inactivated at 80°C for 10 min. Finally, 10 U of exonuclease V (RecBCD) (NEB) was added directly to the reaction along with additional 0.5 mM ATP and incubated at 37°C for 30 min to remove any remaining linear DNA. Following bacterial transformation and blue–white selection, white colonies were selected for further verification.