The largest database of trusted experimental protocols

Maxima sybr green qpcr master mix

Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, Lithuania, Canada, China, Switzerland, United Kingdom, Czechia, Italy

Maxima SYBR Green qPCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) applications. It contains SYBR Green I dye, Maxima Hot Start DNA Polymerase, dNTPs, and buffer components optimized for sensitive and reproducible gene expression analysis.

Automatically generated - may contain errors

510 protocols using maxima sybr green qpcr master mix

1

Testes RNA Extraction and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from testes tissue after removal of the tunica albuginea using TRIzol reagent according to manufacturer’s protocol (Life Technologies, Carlsbad, United States). The concentration and purity of isolated RNA was measured by a NanoDrop instrument (Peqlab, Erlangen, Germany). After DNAseI treatment of RNA, cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany). Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed on ViiA 7 Real-Time PCR System (Applied Biosystems, distributed by Life Technologies) using Maxima SYBR Green qPCR Master Mix (Life Technologies) as described previously (Jostes et al., 2017 (link)). At the end of each PCR run, a melting point analysis was performed. GAPDH was used as reference gene for data normalization.
+ Open protocol
+ Expand
2

Testis RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from testis tissue with TRIzol (Life Technologies, Carlsbad, USA). RNA concentrations and purity ratios were determined by NanoDrop measurement (Peqlab, Erlangen, Germany). qRT-PCR was performed as described previously64 (link). First strand cDNA synthesis was carried out using RevertAid First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany) after DNAseI treatment of RNA. qRT-PCR was performed on ViiA 7 Real Time PCR System (Applied Biosystems, distributed by Life Technologies) using Maxima SYBR Green qPCR Master Mix (Life Technologies). At the end of each PCR run, a melting point analysis was performed. Actin-beta was used as reference gene for data normalization. See Supplementary Table 1 for primer sequences.
+ Open protocol
+ Expand
3

Chromatin Immunoprecipitation Assay for Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells growing in 10 or 15-cm plates were cultured in RPMI 1640 (ATCC, 30–2001) supplemented with 5% (v/v) charcoal stripped fetal bovine serum (CSS) (Gibco, A33821) for 48h. Plates were then treated in biological replicates with vehicle, 5μM MDV or 5μM MDV + 10μM Enzastaurin for 24h. Samples were subsequently processed using the Zymo-Spin ChIP Kit (D5209) and either a H3T6ph antibody (Abcam, ab222768), H3K4Me2 (Cell Signaling Technology, 9725), H3K4Me1 (Cell Signaling Technology, 5326), LSD1 (Abcam, 129195) or a rabbit IgG antibody (Cell Signaling Technology, 2729). The precipitated DNA was evaluated by qRT-PCR using the Maxima SYBR Green qPCR Master Mix (Life Technologies) on a Bio-Rad CFX Touch Real-Time PCR system according to manufacturer instructions. Data is reported as percent of input. Primer sequences are as follows: ARBS2d’ forward: GCT CAG AGA GGT TTT AGT TGT G, ARBS2d’ reverse: CAA AAT GTC TAA GCT GGA AGC AC; ARBS2b’ forward: GTC TTG CTT TCC TAG AAG GTG AC; ARBS2b’ reverse: CAA GGA GAA AAT CTG AGT CCT GAG; ARBS2b forward: CAC ATG GAG TGC TGT TTG GT, ARBS2b reverse: GTA AAC ATC AGT GAG GAT GGT G; ARBS2e forward: GCA GAG AGT TTT TGG TGC ATA TC, ARBS2e reverse: CAA AGA TAC CTG ATG AAG GCT CTG; ARBS2g forward: CAG ACT TTA GAT TTA GGG GTT GG, ARBS2g reverse: GTC TAT GGC TGC TTT CAT CCT AC.
+ Open protocol
+ Expand
4

ChIP-qPCR Analysis of Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells growing in 10 or 15-cm plates were cultured in RPMI 1640 (ATCC, 30-2001) supplemented with 5% (v/v) charcoal stripped fetal bovine serum (CSS) (Gibco, A33821) for 48 h. Plates were then treated in biological replicates with vehicle, 5 μM MDV or 5 μM MDV + 10 μM Enzastaurin for 24 h. Samples were subsequently processed using the Zymo-Spin ChIP Kit (D5209) and either a H3T6ph antibody (Abcam, ab222768), H3K4Me2 (Cell Signaling Technology, 9725), H3K4Me1 (Cell Signaling Technology, 5326), LSD1 (Abcam, 129195) or a rabbit IgG antibody (Cell Signaling Technology, 2729). The precipitated DNA was evaluated by qRT-PCR using the Maxima SYBR Green qPCR Master Mix (Life Technologies) on a Bio-Rad CFX Touch Real-Time PCR system according to manufacturer instructions. Data is reported as percent of input. Primer sequences are as follows: ARBS2d’ forward: GCT CAG AGA GGT TTT AGT TGT G, ARBS2d’ reverse: CAA AAT GTC TAA GCT GGA AGC AC; ARBS2b’ forward: GTC TTG CTT TCC TAG AAG GTG AC; ARBS2b’ reverse: CAA GGA GAA AAT CTG AGT CCT GAG; ARBS2b forward: CAC ATG GAG TGC TGT TTG GT, ARBS2b reverse: GTA AAC ATC AGT GAG GAT GGT G; ARBS2e forward: GCA GAG AGT TTT TGG TGC ATA TC, ARBS2e reverse: CAA AGA TAC CTG ATG AAG GCT CTG; ARBS2g forward: CAG ACT TTA GAT TTA GGG GTT GG, ARBS2g reverse: GTC TAT GGC TGC TTT CAT CCT AC.
+ Open protocol
+ Expand
5

Gene Expression Analysis in Testes

Check if the same lab product or an alternative is used in the 5 most similar protocols
After removal of the tunica albuginea from testes tissue, RNA isolation using TRIzol reagent according to manufacturer's protocol (Life Technologies) was performed. The concentration and purity of isolated RNA was measured using NanoDrop (Peqlab). After DNaseI treatment of RNA, cDNA synthesis was performed using the RevertAid First Strand cDNA Synthesis Kit (Fermentas, now Thermo Fisher Scientific). qRT-PCR was performed using Maxima SYBR Green qPCR Master Mix (Life Technologies) on ViiA 7 Real Time PCR System (Applied Biosystems, distributed by Life Technologies) as described previously (Umer et al., 2021 (link)). At the end of each PCR run, a melting point analysis was performed. Gapdh was used as reference gene for data normalization.
+ Open protocol
+ Expand
6

Transcriptomic Analysis of Neuropeptides

Check if the same lab product or an alternative is used in the 5 most similar protocols
We extracted total RNA with TRIzol (Life Technologies, Grand Island, NY, USA), and then, samples were treated with RQ1-DNAse (Promega, Madison, WI, USA) following the manufacturer's instructions. Total RNA (2 μg) was reverse-transcribed in a 25 μL reaction volume with random primers (Promega) and M-MLV reverse transcriptase (Promega). The levels of mRNA of key neuropeptides were assessed by RT-qPCR using the CFX Connect Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The analysis was performed in a reaction volume of 15 μL containing 2 μL cDNA from each sample (1 : 4 previous dilution), 0.5 μM of primers (forward and reverse, Table 1), and Maxima SYBR Green qPCR Master Mix (Life Technologies). The thermal cycling consisted of (1) hot start iTaq DNA polymerase incubation for 10 min at 95°C, (2) 40 heating cycles of 15 s each at 95°C for 15 s, and (3) 40 s of annealing and extension at 60°C. When finished, we performed melting curves (0.5°C/5 s temperature gradient from 65 to 95°C) to guarantee the amplification of one fragment. We also carried out two types of negative controls in each qPCR, i.e., samples without RNA and samples without RT. We calculated the relative mRNA abundance of evaluated transcripts using actb (β-actin) and eef1a1 (elongation factor 1α) as reference transcripts [25 (link)].
+ Open protocol
+ Expand
7

Quantifying SARS-CoV-2-Induced Interferon Response

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA of Calu‐3 cells infected with SARS–CoV‐2 wt or Nsp16mut (0.15 copies/cell) or mock infected cells was isolated 24 hpi using the NucleoSpin RNA Mini Kit (Machery & Nagel) according to manufacturer's instructions. To quantify transcript level of the interferon‐stimulated genes (ISGs) MxA, ISG15, and IFN β by RT–qPCR, 2.5 μg of total RNA was reverse transcribed using oligo‐dT primer and Superscript II RT (Life Technologies). Quantitative PCR was performed in triplicates using the Maxima SYBR Green qPCR Mastermix (Life Technologies) on an ABI Prism 7500 cycler (Applied Biosystems). Expression levels of ISGs were normalized to GAPDH using the 2−ΔΔCt method. Oligonucleotides for qPCR: MxA 5′‐TCCAGCCACCATTCCAAG‐3′ (forward) and 5′‐CAACAAGTTAAATGGTATCACAGAGC‐3′ (reverse); ISG15 5′‐GTCTGGCTGTCCACCCGAGC‐3′ (forward) and 5′‐CGTGCTGCCGGGGCCCAGGC‐3′ (reverse); IFN‐beta 5′‐CTTT GCTATTTTCAGACAAGATTCA‐3′ (forward) and 5′‐GCCAGGAGGTTCTCAACAAT‐3′ (reverse), GAPDH 5′‐GGAGTCCCTGCCACACTCAG‐3′ (forward) and 5′‐GGTCTACATGGCAACTGTGAGG‐3′ (reverse).
+ Open protocol
+ Expand
8

Hypothalamus RNA Extraction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from hypothalamus samples (approx. 20 mg) using Trizol reagent (Life Technologies, NY, USA), following manufacturer's instructions, and RNA quantity and quality was evaluated by spectrophotometry (NanoDrop 2000, Thermo Fisher Scientific) . Two µg of total RNA were reverse transcribed into cDNA using Superscript II reverse transcriptase (Promega, Madison, Wi, USA) and random hexaprimers (Promega). Gene expression levels were determined by real-time quantitative RT-PCR (q-PCR) using the iCycler iQ (BIO-RAD, Hercules, CA, USA). Analyses were performed on 5 µl of diluted (1/50) cDNA using the MAXIMA SYBR Green qPCR Mastermix (Life Technologies), in a total PCR reaction volume of 15 µl, containing 120 nM of each primer. Sequences of the forward and reverse primers used for the two gene expression assay are shown in Table 1. Relative quantification of the target genes was done using ubiquitin (ubq) as reference gene (Infante et al., 2008) . Thermal cycling was initiated with
+ Open protocol
+ Expand
9

Quantitative Real-Time PCR for Extraction Efficiency

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative real-time PCR (qPCR) was used to further verify the extraction efficiency of the investigated MILs. The forward primer AP2DF (5′-CTCAACTTCCCCTTTGTGGA-3′) and the reverse primer AP2DR (5′-CATATTGCAATCCCCTCCTC-3′) were used for the amplification of the AP2D (AP2 domain At4g34410) region (the primers were designed using Primer 3 software) [21 , 29 (link)]. Analyses were performed in triplicate on DNA samples and control samples which included non-template controls to confirm the absence of contamination. All experiments were performed on a Stratagene Mx3000P™ Real-Time PCR System (Agilent Technologies, Santa Clara, CA USA) using SYBR Green I with ROX as an internal loading standard. The real-time PCR amplification was performed by using 0.6 μl of DNA with 0.3 μl of 10 μM primers, 5 μl of 2X Maxima™ SYBR green qPCR Master mix (Thermo Fisher, Waltham, MA USA) and sterile water up to 10 μl total volume. PCR conditions were as follow: 95 °C for 10 min, 95 °C for 20 s, 57 °C for 30 s, 72 °C for 35 s, 95 °C for 1 min, 55 °C for 30 s and 95 °C for 30 s. Fluorescence was read following each annealing and extension phase. All runs were followed by a melting curve analysis from 55 to 95 °C.
All amplification plots were analysed with MX3000P™ software to obtain Ct values.
+ Open protocol
+ Expand
10

Validating Gene and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
To validate gene expression changes, 1 μg of total RNA was used for cDNA synthesis with RevertAid RT Kit (ThermoFisher Scientific, USA) according to manufacturer’s instructions. To evaluate miRNA expression, 0.2 μg of total RNA was used to perform cDNA synthesis with RevertAid RT Kit (ThermoFisher Scientific, USA) as described previously [16 (link)]. Quantitative real-time PCR (qRT-PCR) was performed on Eco™ RT-PCR system (Illumina, Inc.) using 2x Maxima SYBR Green qPCR MasterMix (ThermoFisher Scientific, USA) according to manufacturer’s instructions. The relative changes in gene and miRNA expression were calculated by ∆∆Ct method comparing expression levels in LLC1 cells grown under 2D and lr-ECM 3D or LLC1 tumors with hprt1 or sno135 as endogenous controls for expression normalization, respectively. The primer sequences used for microarray data validation are shown in Additional file 1: Table S1.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!