Total RNA was extracted using TRIzol (Accurate Biology, AG21101, Hunan, China), reverse-transcribed using random primers and reverse transcriptase (Yeasen, 11121ES60, Shanghai, China). qRT-PCR was performed on a real-time PCR system (CFX96 Connect, Bio-Rad, USA) using the qPCR SYBR Master Mix (Yeasen, 11203ES03, Shanghai, China). The expression levels were determined with the obtained threshold cycle values using the 2−△△Ct method. β-Actin was used as the housekeeping gene in this study. The primer sequences used were as follows: lrpap1-Forward: 5’-GCAACAACCAGGTGGAAT-3’; lrpap1-Reverse: 5’-TCAAGTCACTGTGTAGTTCTG-3’; β-actin-Forward: 5’-TTCTTGGGTATGGAATCTTGCGGTATC-3’; β-actin-Reverse: 5’-CAGTGTTGGCATACAGGTCCTTACG-3’.
Trizol
Manufactured by Accurate Biology
Sourced in China
TRIzol is a ready-to-use reagent for the isolation of total RNA, DNA, and proteins from a variety of biological samples. It is a monophasic solution of phenol, guanidine isothiocyanate, and other proprietary components that facilitate the isolation and purification of the desired biomolecules.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green premix pro taq hs qpcr kit, by Accurate Biology (7 mentions)
Reverse transcription kit, by Accurate Biology (3 mentions)
Sybr green pcr kit, by Accurate Biology (2 mentions)
Rna extraction kit, by Thermo Fisher Scientific (2 mentions)
Evo m mlv rt kit with gdna clean, by Accurate Biology (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 system, by Thermo Fisher Scientific (2 mentions)
Mir 21a 5p primer, by Takara Bio (2 mentions)
Exo m mlv rt kit with gdna clean for qpcr 2, by Accurate Biology (2 mentions)
Lightcycler 480ii fast real time pcr system, by Roche (2 mentions)
Mir xtm mirna first strand synthesis kit, by Takara Bio (2 mentions)
Cfx96 connect, by Bio-Rad (1 mentions)
Magicsybr mixture, by CWBIO (1 mentions)
Hifiscript gdna removal cdna synthesis kit, by CWBIO (1 mentions)
Hiscript q select rt supermix kit, by Vazyme (1 mentions)
Icycler iq5 multicolor, by Bio-Rad (1 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
33 protocols using trizol
1
qRT-PCR Analysis of lrpap1 Expression
2
Drosophila RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the manufacturer’s instructions, Drosophila adults were homogenized in 1 mL TRIzol (Accurate Biotechnology, Hunan, China) with sterilized steel balls. The RNA samples were dissolved in an appropriate amount of DEPC water. NanoDrop 2000 spectrophotometer (ThermoFisher) was used to quantify the concentration and purity of total RNA in each sample at a wavelength of 260 nm. The HiFiScript gDNA Removal cDNA Synthesis Kit (CWBIO, Jiangsu, China) was used to synthesize cDNA. Three biological replicates were used for quantitative reverse transcription PCR analysis using MagicSYBR Mixture (CWBIO). The relative mRNA level of gene expression was measured with Rp49 as internal control by calculating the values of ΔCtGene/ΔCtRp49 and analyzed by the 2−ΔΔCt method. Primers used in this study are listed in Supplementary Table S1 .
3
Quantifying P2RY12 Expression in Mouse Spinal Cord
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from spinal cord samples was extracted by Trizol (Accurate Biology, China), and reverse transcription was performed using SPARKscript reverse transcription (SparkJade, China). Quantitative real time PCR (qRT-PCR) was carried out using a quantitative SPARKscript PCR Kit (SparkJade, China). Two microliters of cDNA were subjected to amplification in a total volume of 20 µL containing 10X buffer, 1.5 mM MgCl2, 0.2 mM of each dNTP, 1 U Taq polymerase, and a pair of primers (0.2 mM each). The program was running at 95°C for 15 s, 60°C for 1 min, 95°C for 15 s, and 40 cycles were repeated. Primers were designed with software Primer 5 and the sequences were as follows: P2RY12 forward primer, CCTGCCTTGATCCATTCATCTA and reverse primer GTCCTTTCTTCTTGTTTGTCCC, GAPDH (mice) forward primer, AAATGGTGAAGGTCGGTGTGAACG, reverse primer, ATCTCCACTTTGCCACTGC. GAPDH was used as an internal reference. The quantitative analysis was carried out using the comparative CT (2−∆∆CT) method.
4
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted in strict accordance with the instructions of Trizol (AG21101, Accurate Biotechnology (Hunan) Co., Ltd., Hunan, China). The primer sequence is in Table S1 . PrimeScript Reverse Transcriptase kit (AG11702-S, Accurate Biotechnology (Hunan)Co., Ltd., China) was used to synthesize cDNA. cDNA was quantified using SYBR Green PCR kit (AG11701-S, Accurate Biotechnology (Hunan)Co., Ltd, China) for quantitative analysis. The expression of the genes was calculated by the 2-ΔΔt method.
5
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from harvested GCO cells using Trizol (Accurate Biology Co. Ltd., Shenzhen, China) according to the manufacturer’s protocol. The quality and the purity of isolated RNA were determined using a Nanodrop 2000c spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). RNA was reverse-transcribed to cDNA using the HiScript Q Select RT Supermix kit (Vazyme, Nanjing, China) for qPCR (+gDNA wiper). The qRT-PCR protocol was as follows: 95 °C for 4 min, and then 38 cycles at 95 °C denaturation for 10 s, followed by annealing at 59 °C for 30 s with a Bio-Rad iCycler IQ5 Multicolor real time PCR detection system. Table 1 shows the primers used for qRT-PCR in the study.
6
Glioma Tissue RNA Extraction and qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from clinical glioma samples according to TRIzol (Accurate Biology, China, AG21101) and RNA extraction kit (Thermo Scientific, K0731). And then, the total RNA was packaged and stored in a refrigerator at -80°C. Before the experiment, the total RNA was taken for amplification to obtain cDNA and qPCR. The PCR reaction conditions were: 95°C 15 min, 95°C 15 s, 60°C; 1 min, and 40 cycles. The amplification efficiency and specificity of the designed primers were analyzed by experimental data, and the specificity of the primers was analyzed by dissolution curve. GenBank queries the gene sequence and designs the primer sequence as follows: TSPAN7: (forward) 5 ‘- STATCCTTCGTCTTCGGATC-3’, (reverse) 5 ‘- CATACAGTTTCAGCATCGG-3’.
7
Quantification of IL18, GSK3B, and VEGFA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNAs was isolated from HPDE6-C7 cell lines and CF-PAC1, Panc-1and BxPC-3 cell lines by extraction tool named TRIzol (Accurate Biotechnology). We utilized the Reverse Transcription Reagent to prepare the cDNAs. RT-PCR was carried out by using qPCR Kit (Accurate Biotechnology). The experiment reagents were from our laboratory. And the GAPDH was served as the control standard. The analysis and quantification of RNA expression level adopted the ΔΔCt method. All the primer sequences obtained from GenePharma (Suzhou, China) were for human, which were as follows: IL18, 5’- TCTTCATTGACCAAGGAAATCGG-3’ (Forward), 5’- TCCGGGGTGCATTATCTCTAC-3’ (Reverse); GSK3B, 5’- GCCCAGAACCACCTCCTTTGC-3’ (Forward), 5’- CACCTTGCTGCCGTCCTTGTC-3’ (Reverse); VEGFA, 5’- GCCTTGCCTTGCTGCTCTACC-3’ (Forward), 5’- CTTCGTGATGATTCTGCCCTCCTC-3’ (Reverse).
8
Microglia Transcriptome Profiling after AZD1390 and LPS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary microglia were pretreated with 10 μM AZD1390 for 2 h and stimulated with LPS (100 ng/mL) for 24 h. Then total RNA was extracted with TRIzol (AG21101, Accurate Biology) and analyzed on a llluminaHiseq 2000 platform (Shanghai Majorbio Bio‐pharm Technology Co., Ltd). Differentially expressed genes (DEGs) were singled out with a adjust p ≤ 0.05 and change fold ≥2.0, subsequently performed the Gene Set Enrichment Analysis through Kyoto Encyclopedia of Genes and Genomes (KEGG).
9
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was performed using Trizol (AG21101, Accurate Biotechnology (Hunan) Co., Ltd., Hunan, China) and then cDNA was synthesized using a PrimeScript Reverse Transcriptase reagent kit (AG11702-S, Accurate Biotechnology (Hunan) Co., Ltd., Hunan, China). The quantitative analyses were conducted using an SYBR Green PCR Kit (AG11701-S, Accurate Biotechnology (Hunan) Co., Ltd., Hunan, China). The gene expressions of all target genes were calculated by the 2−ΔΔCt method and standardized to the housekeeping gene β-actin. The gene primer sequences are shown in Table 1 .
10
RNA Extraction from Mouse Pancreas
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After sacrificing the mice, the pancreases were harvested and immediately frozen in liquid nitrogen. Pancreas samples were ground with 1 mL of TRIzol® (Accurate Biotechnology, China) and total RNA was extracted after the successive addition of chloroform and isopropanol. cDNA synthesis was conducted in accordance with the manufacturer’s instructions. The SYBR™ Green kit (Accurate Biotechnology, China) was used to examine gene expression using a BioTek Cytation 3 instrument (Hangzhou, China). All primers were purchased from Sangong Biotech Co. (Shanghai, China) and are shown in Table 1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!