cDNA was synthesized with oligo (dt) primer for mRNA, using PrimeScriptTM RT Master Mix (Takara, Otsu, Japan). qPCR was performed using the SYBR Premix Ex TaqTM (Tli RNaseH Plus) (Takara, Otsu, Japan) on the LC480 Real-Time PCR System (Roche, Basel, Switzerland) in accordance with the manufacturer’s instructions (the primers are listed in Supplementary Tables 1 , 2 ). cDNA was synthesized with A tail for miRNA, miRcute Plus miRNA Firsr-Strand cDNA Synthesis Kit (Tiangen, Beijing, China), and qPCR was performed using miRcute Plus miRNA qPCR Detection Kit (Tiangen, Beijing, China) on the LC480 Real-Time PCR System (Roche, Basel, Switzerland) in accordance with the manufacturer’s instructions. GAPDH was used as an endogenous control gene for mRNA and U6 was used for miRNA. We used the 2-ΔΔCT method to analyze these data. qPCR in each reaction was performed in triplicate, and the data were expressed as the mean ± standard error (n = 3).
Lc480 real time pcr system
Manufactured by Roche
Sourced in Switzerland, Japan, United States, Austria, China
The LC480 Real-Time PCR System is a laboratory instrument used for quantitative polymerase chain reaction (qPCR) analysis. It is designed to perform real-time detection and quantification of nucleic acid sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (16 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (6 mentions)
Lightcycler 480, by Roche (6 mentions)
Superscript vilo cdna synthesis kit, by Thermo Fisher Scientific (5 mentions)
Sybr qpcr master mix, by Vazyme (3 mentions)
Primescript rt reagent kit, by Takara Bio (3 mentions)
Sybr qpcr master mix, by Bio-Rad (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Total rna purification kit, by EZBioscience (2 mentions)
Hiscript 3 rt supermix, by Vazyme (2 mentions)
Genomic dna purification kit, by Tiangen Biotech (2 mentions)
Sybr green pcr master mix, by Roche (2 mentions)
Sybr green luna universal qpcr master mix, by New England Biolabs (2 mentions)
Mirneasy mini kit, by Qiagen (2 mentions)
Lunascript rt supermix kit, by New England Biolabs (2 mentions)
Mircute plus mirna qpcr detection kit, by Tiangen Biotech (2 mentions)
Sybr premix ex taqtm tli rnaseh plus, by Takara Bio (2 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Chloroform, by Merck Group (2 mentions)
46 protocols using lc480 real time pcr system
1
Quantitative Real-Time PCR for mRNA and miRNA
2
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was isolated using Trizol reagent in accordance with the manufacturer’s protocol (Invitrogen). The quality and quantity of RNA were assessed using NanoDrop 2000 (Thermo Scientific, Waltham, MA, USA). cDNA was synthesised with 1 microgram of total RNA using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). qRT-PCR was performed with LightCycler 480 SYBR Green Master (Roche, Basel, Switzerland) according to the manufacturer’s instructions. Signals were detected using the Roche LC480 Real-Time PCR System (Roche, Switzerland). The relative expression level was determined using the ΔΔCt method and normalised to the GAPDH levels. All primer sequences for qRT-PCR are listed in Table S15 .
3
Expression of Core HRGs in AS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A total of 14 individuals, including 7 healthy subjects and 7 individuals diagnosed with AS, were recruited for blood sample collection at the First Affiliated Hospital of Heilongjiang University of Traditional Chinese Medicine. Informed consent was obtained from all participants prior to sample collection, ensuring compliance with ethical guidelines. Furthermore, the study procedures were approved by the Ethics Committee at the First Affiliated Hospital of Heilongjiang University of Traditional Chinese Medicine.
Blood samples were subjected to RNA extraction using TRIzol reagent (ThermoFisher, USA). To perform qRT-PCR analysis, the SYBR qPCR Master Mix (Bio-Rad) was utilized. The expression of the primary core HRGs was assessed using the Roche LC480 Real-Time PCR System (Roche). β-actin was used as a reference gene for mRNA normalization. Therelative mRNA expression levels were quantified using the 2 - ΔΔCt method.
Blood samples were subjected to RNA extraction using TRIzol reagent (ThermoFisher, USA). To perform qRT-PCR analysis, the SYBR qPCR Master Mix (Bio-Rad) was utilized. The expression of the primary core HRGs was assessed using the Roche LC480 Real-Time PCR System (Roche). β-actin was used as a reference gene for mRNA normalization. Therelative mRNA expression levels were quantified using the 2 - ΔΔCt method.
4
Transcriptional Profiling of Arterial Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples of arterial tissue were obtained from the popliteal arteries of 8 AS patients at Changshu Hospital Affiliated to Soochow University. During open surgical procedures for repairing full-thickness abdominal aortic aneurysms, tissue samples from 8 AAA were collected, while tissue from six healthy visceral aortas was sourced from organ donors at the time of kidney transplants taking place at Changshu Hospital Affiliated to Soochow University. Before collecting data, we obtained written consent from all participants and received approval for the study protocol from the Ethics Committee of Changshu Hospital Affiliated to Soochow University. Supplementary Table S2 displays the baseline characteristics of the participants.
The TRIzol reagent (Invitrogen, Thermo Fisher) was used to process tissue samples for RNA extraction, following the instructions provided by the manufacturer. Quantitative real-time PCR (qRT-PCR) analysis was performed using the SYBR qPCR Master Mix (Bio-Rad) after reverse transcription of total RNA to cDNA with cDNA synthesis kits (Invitrogen, Thermo Fisher). We utilized the Roche LC480 Real-Time PCR System to quantify the expression levels of the signature genes. The internal control for mRNA, GAPDH, was employed in this study.
The TRIzol reagent (Invitrogen, Thermo Fisher) was used to process tissue samples for RNA extraction, following the instructions provided by the manufacturer. Quantitative real-time PCR (qRT-PCR) analysis was performed using the SYBR qPCR Master Mix (Bio-Rad) after reverse transcription of total RNA to cDNA with cDNA synthesis kits (Invitrogen, Thermo Fisher). We utilized the Roche LC480 Real-Time PCR System to quantify the expression levels of the signature genes. The internal control for mRNA, GAPDH, was employed in this study.
5
Quantifying mRNA Expression Using RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using a Total RNA Purification Kit (B0004-plus; EZBioscience, Suzhou, China), and cDNA was reverse-transcribed from 1 μg total RNA using HiScript III RT SuperMix (R312-01; Vazyme, Nanjing, China) according to the manufacturer’s protocol. RT-qPCR was performed in triplicate in 96-well plates using SYBR qPCR Master Mix (Q111-02; Vazyme) with gene-specific forward and reverse primers. cDNA was amplified for 40 cycles using a Roche LC480 Real-time PCR system. Gapdh or GAPDH was used as a reference gene.
For comparisons, mRNA expression levels were normalized to those of the blank/culture medium treatment condition for each subject. The primers were as follows:
Mouse Cyp19a1 forward: 5′-AACCCCATGCAGTATAATGTCAC-3′;
Mouse Cyp19a1 reverse: 5′-AGGACCTGGTATTGAAGACGAG-3′;
Mouse Gapdh forward: 5′- AGGTCGGTGTGAACGGATTTG-3';
Mouse Gapdh reverse: 5′-TGTAGACCATGTAGTTGAGGTCA-3′;
Human CYP19A1 forward: 5′-TCCTATCAGGACGGAAGGTCC-3′;
Human CYP19A1 forward: 5′-GTTCCTTGACCTCAGAGGGG-3′;
Human GAPDH forward: 5′-GGGAAGCTTGTCATCAATGGAA-3′; and
Human GAPDH reverse: 5′-AGAGATGATGACCCTTTTGGCTC-3′.
For comparisons, mRNA expression levels were normalized to those of the blank/culture medium treatment condition for each subject. The primers were as follows:
Mouse Cyp19a1 forward: 5′-AACCCCATGCAGTATAATGTCAC-3′;
Mouse Cyp19a1 reverse: 5′-AGGACCTGGTATTGAAGACGAG-3′;
Mouse Gapdh forward: 5′- AGGTCGGTGTGAACGGATTTG-3';
Mouse Gapdh reverse: 5′-TGTAGACCATGTAGTTGAGGTCA-3′;
Human CYP19A1 forward: 5′-TCCTATCAGGACGGAAGGTCC-3′;
Human CYP19A1 forward: 5′-GTTCCTTGACCTCAGAGGGG-3′;
Human GAPDH forward: 5′-GGGAAGCTTGTCATCAATGGAA-3′; and
Human GAPDH reverse: 5′-AGAGATGATGACCCTTTTGGCTC-3′.
6
Validating Microarray Findings by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The validation cohort included 16 neonates and 16 adults. Selected genes were used to validate microarray results by qRT-PCR. Retro-transcription reaction was performed using 150 ng of total RNA for each sample, according to the manufacturer’s instructions (SuperScript III First Strand, Thermo Fisher Scientific). Taqman Premix Ex Taq (Takara Bio Inc.) and a commercial probe for GNAZ (Hs00157731_m1), GNB5 (Hs00272529_m1), RANBP10 (Hs00398714_m1), PIK3CG (Hs00932390_m1), RPL32 (Hs00851655_g1), PRDX2 (Hs00853603_s1), and ACTB (Hs99999903_m1) Taqman Gene Expression Assay (Thermo Fisher Scientific) and SYBR Premix Ex Taq (Takara Bio Inc.) with ADRA2A- and ACTB-specific primers (ADRA2A-F: CGACCAGAAGTGGTACGTCA ; ADRA2A-R: TAGATGCGCACGTAGACCAG ; ACTB-F: TAGCACAGCCTGGATAGCAA , and ACTB-R: TGACCCAGATCATGTTTGAGA ) were used for PCR on a LC480 Real Time PCR system (Roche Pharma, Basel, Switzerland).
7
Quantitative RT-PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from ~50 mg of tissue or 107 cultured cells with an RNA extraction kit (Omega Bio-tek, Inc., Norcross, GA, USA) according to the manufacturer's protocol. The cDNA was reverse transcribed using the PrimeScript RT reagent kit (Takara Bio, Inc.). Fold changes in respective gene expression were calculated by normalizing to the level of the house-keeping gene GAPDH. The primer sequences designed for RT-qPCR analysis are shown in Table I . PCR amplification was performed in an LC-480 real-time PCR system (Roche Diagnostics GmbH) in a 20-µl reaction volume consisting of 10 µl 2X SYBR Green II PCR Master Mix (Takara Bio, Inc.), 1 µl each forward and reverse primer, 6 µl distilled water and 2 µl the sample cDNA. The amplification conditions were as follows: 95°C for 5 min; 45 cycles of 95°C for 10 sec, 60°C for 20 sec and 72°C for 20 sec; followed by 95°C for 5 sec and 65°C for 60 sec. The relative mRNA expression was calculated using the 2−∆∆Cq method.
8
Quantification of mtDNA Common Deletion
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA of the auditory cortex was extracted using a Genomic DNA Purification kit (Tiangen Biotech Co., Ltd., Beijing, China), and TaqMan (Tiangen Biotech Co., Ltd.) quantitative polymerase chain reaction (qPCR) analysis was used to determine the proportion of the mtDNA common deletion (CD). The D-Loop region copy was used as the conservative segment. The primers and probes for the mtDNA CD and mtDNA D-loop are listed in Table I , as previously described (40 (link)). PCR amplification was performed using a LC-480 real-time PCR system (Roche Diagnostics, Basel, Switzerland) in a 20-μl reaction volume. The cycling conditions included an initial phase at 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and at 60°C for 30 sec. ΔCq (Cqdeletion−CqD-loop) was used to reflect the abundance of the mtDNA 4,834-bp deletion. The relative expression indicating the factorial difference in the deletions between the NS group and the D-gal-treated group was calculated using the 2−ΔΔCq method (41 (link)), where ΔΔCq=ΔCqmtDNA deletion in D-gal-treated group − ΔCqmtDNA deletion in NS group.
9
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cells was isolated using the RNA Easy Fast Tissue/Cell Kit (Tiangen, China). After that, RNA was converted to cDNA using All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (Transgen, Beijing, China). Real-time PCR was performed using the TB Green™ Premix Ex Taq™ II Kit (Takara, Tokyo, Japan) on an LC480 real-time PCR system (Roche, Basel, Switzerland). Experiments were performed in triplicate. All data were quantified using the 2−ΔΔCT method in relative quantification and normalized to GAPDH mRNA expression. The primer sequences of the target genes are shown in Table 1 .
10
Quantification of miR-29b in Cardiac Fibroblasts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cardiac fibroblasts was extracted using TRIzol™ Reagent (Thermo, USA) according to the manufacturer’s protocol. RNA concentration was determined by Nanodrop 2000 and was reverse transcribed into complementary DNA. Quantification of miR-29b was done by LC480 Real-time PCR system (Roche, USA) using SYBR Green PCR Master Mix (Roche, USA) PCR cycling protocol: 95 ℃ for 10 min, 40 cycles at 95 ℃ for 15 s, 60 ℃ for 30 s and 72 ℃ for 30 s. U6 was used as an internal control and the amount of miR-29b was calculated according to 2–ΔΔCt. The sequences of primers used in this study were: miR-29b, forward: 5'-GCGGTAGCACCATTTGAAATCAGT-3' and reverse: 5'-ATCCAGTGCAGGGTCCGAGG-3'; U6 forward: 5'-GCTTCGGCACATATACTAAAAT-3' and reverse: 5'-CGCTTCACGAATTTGCGTGTCAT-3'.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!