Lightcycler 96 thermal cycler

Total RNA from cultured HUVECs or previously homogenized mouse tissues was isolated and purified using the SpeedTools kit (Biotools), or the RNeasy kit (170-8891; iScript cDNA Synthesis kit; BioRad). One μg of total RNA from each sample was retrotranscribed into cDNA with the iScript cDNA Synthesis kit (BioRad) in a final volume of 20 μL, following the manufacturer’s instructions. The resulting cDNA was used as a template for subsequent quantitative real-time PCR. For qRT-PCR assays of human BMP4, specific oligonucleotides labeled with FAM (Hs03676628_s1; TaqMan Gene Expression Assays, Applied Biosystems), and Roche’s FastStart Essential DNA Probes Master Mix containing Taq DNA Polymerase (Life Science). Amplification experiments were performed with the iQ5 thermal cycler (Bio-Rad). The qRT-PCR of murine Bmp4 was carried out using the iQTM SYBR^® Green Supermix (170-8880; BioRad), and mouse Bmp4 specific oligonucleotides (Forward, CGTTACCTCAAGGGAGTGGA; Reverse, ATGCTTGGGACTACGTTTGG). DNA amplification was performed with the Roche LightCycler 96 thermal cycler, using human or murine 18S ribosomal RNA as an internal control. Samples were analyzed in triplicate, and each experiment was repeated at least three times. Results were normalized with respect to the expression levels of the 18S ribosomal RNA by the 2^−ΔΔCt method.

Viral or total cellular DNA was extracted with a DNAeasy kit (Qiagen, Courtaboeuf, France) and the DNA concentration and purity were determined using a Nanodrop spectrophotometer. Real-time PCR was performed using different dilutions of the purified total DNA and the QuantiTect SYBR green PCR master (Qiagen, Courtaboeuf, France) with a LightCycler 96 thermal cycler (Roche Applied Science, Meylan, France), using the E11L primers previously described [51 (link)]. For relative quantification, the 2^−ΔΔCt method was used [52 (link)]. The quantification of copies per millilitre was performed against a standard curve of WR virions. The number of viral DNA copies was evaluated either by Nanodrop (1 ng DNA viral DNA = 4.74 × 10⁶ copies) or directly by the qPCR assay.

Real-time PCR assays were conducted on three different PCR platforms (P1, P2, P3). (P1) LightCycler® 96 thermal cycler, (P2) LightCycler® Nano and (P3) LightCycler® 2.0 Instruments (Roche Diagnostics, Risch-Rotkreuz, Switzerland) were used with the LightCycler 480 High-Resolution Melting Master (Roche Applied Science, Penzberg, Germany) (P1) 10 μl reaction volumes consisted of 5 μl 2× LightCycler 480 High Resolution Melting Master, 0.5 μl of each primer (0.4 μM), 1 μl MgCl₂ (2 mM) and 3 μl template DNA. The thermocycling reactions were conducted in a LightCycler 480 Multiwell Plate, (white). (P2), (P3) 20 μl reaction volumes consisted of 10 μl 2× LightCycler 480 High Resolution Melting Master, 0.5 μl of each primer (0.4 μM), 5 μl PCR grade water, 1 μl MgCl₂ (2 mM) and 3 μl template DNA. The thermocycling reactions were conducted in LightCycler® 8-Tube Strips (P2) and in 20 μl glass capillaries (P3). The real-time PCR runs always included at least two controls of reaction mix without DNA (non-template control - NTC). Temperature parameters were set as follows: an initial denaturing step of 95 °C for 10 min followed by 50 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 10 s and extension at 72 °C for 10 s. Fluorescent data were collected in the ResolightDye channel (470/514 nm).

The Y. pseudotuberculosis strain was cultured in YLB medium in a shaker to OD₆₀₀ = 1.0, and the cells were harvested by centrifugation. Total RNA was isolated using the Steadypure Universal RNA Extraction Kit AG21017 (Accurate Biotech, Hunan, China) following the manufacturer’s instructions. cDNA was synthesized by Evo M-MLV RT Reaction Mix Kit AG11728 (Accurate Biotech, Hunan, China). qRT-PCR was then performed using the SYBR Green Pro Taq HS Premix (Accurate Biotech, Hunan, China) in the LightCycler 96 thermal cycler (Roche, USA). The 16S rRNA gene served as a housekeeping gene to normalize mRNA abundance.

Total RNA was extracted from leaves and tubers using the method described previously by Stiekema et al. [48 (link)]. RNA concentration and quality were tested using a NanoDrop spectrophotometer and reverse transcribed into first-strand cDNA using the Maxima H minus First Strand cDNA Synthesis Kit with dsDNase (Thermo Scientific Molecular Biology, Waltham, MA, USA). Semi-quantitative reverse transcription PCR (RT-PCR) analysis of the cDNAs was carried out using the ACTIN, GI.04spec and GI.12spec primer pairs (Additional file 2: Table S2) and visualising the PCR products on agarose gels. For these PCR amplifications, DreamTaq DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) was used.
RT-qPCR assays were performed using a Light Cycler-96 thermal cycler (Roche Diagnostics GmbH, Mannheim, Germany) and a Luminaris Color HiGreen Flourescein qPCR Master Mix (Thermo Scientific Molecular Biology, Waltham, MA, USA). ACTIN and EF1α served as reference genes [49 (link)]. Primers are listed in Additional file 2: Table S2.