mRNA was extracted from lung tissue using the Qiagen RNA extraction kit (74104, Qiagen) and reverse transcribed with SuperScript III Reverse Tran- scriptase (Life Technologies). TaqMan primers for gene expression assays were purchased from Life Technologies. Real-time qPCR was carried out with an ABI PRISM 7300 Sequence Detection System using TaqMan PCR Master Mix (Life Technologies). mRNA was extracted from cells using the Qiagen RNA extraction kit (74104, Qiagen) and reverse transcribed with SuperScript III Reverse Transcriptase (Life Technologies). mRNA in Supplementary Fig. 4f was used from RIP-Seq library preparations. TaqMan primers for human transferrin Receptor 1, human ferritin Heavy chain, human frataxin and human beta-actin for gene expression assays were purchased from Life Technologies. Real-time qPCR was carried out with an ABI PRISM 7300 Sequence Detection System using TaqMan PCR Master Mix (Life Technologies).
Abi prism 7300 sequence detection system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, Germany, China, Canada, United Kingdom
The ABI Prism 7300 Sequence Detection System is a real-time PCR instrument designed for gene expression analysis and quantification. It utilizes fluorescence-based detection technology to monitor the amplification of DNA sequences in real-time during the PCR process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (81 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (31 mentions)
Trizol, by Thermo Fisher Scientific (30 mentions)
Rneasy mini kit, by Qiagen (26 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (21 mentions)
Primescript rt reagent kit, by Takara Bio (17 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (13 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (13 mentions)
Sybr premix ex taq 2 perfect real time kit, by Takara Bio (11 mentions)
Iscript cdna synthesis kit, by Bio-Rad (10 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (9 mentions)
Powerup sybr green master mix, by Thermo Fisher Scientific (9 mentions)
M mlv reverse transcriptase, by Promega (8 mentions)
Thunderbird sybr qpcr mix, by Toyobo (8 mentions)
Trizol, by Takara Bio (8 mentions)
Trizol reagent, by Takara Bio (7 mentions)
Tri reagent protocol, by Merck Group (7 mentions)
Sybr green pcr master mix, by Takara Bio (7 mentions)
Taqman human mirna assay kit, by Thermo Fisher Scientific (6 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (6 mentions)
349 protocols using abi prism 7300 sequence detection system
1
Quantitative RT-PCR Analysis of Gene Expression
2
Quantitative RT-PCR Analysis of Gene Expression
3
Quantifying Ovarian Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from murine ovary tissue using a TRIzol reagent kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. RNA (1 µg) was transcribed into cDNA using a PrimeScript™ RT reagent kit (Takara Biotechnology Co., Ltd., Dalian, China). qPCR reactions were performed using a Light Cycler Fast Start DNA Master SYBR-Green I kit and an ABI Prism 7300 Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.) The thermocycling conditions were as follows: 95°C for 3 min; 95°C for 15 sec; 60°C for 15 sec; 72°C for 1 min (35 cycles); and 72°C for 10 min. The relative expression of genes was determined using the 2−ΔΔCq method (19 (link)) with normalization to 36B4 expression. The primer sequences were as follows: LH receptor (LHR) forward, 5′-AATGAGTCCATCACGCTGAAAC-3′ and reverse, 5′-CCTGCAATTTGGTGGAAGAGA-3′; FSHR forward, 5′-CCTTGCTCCTGGTCTCCTTG-3′ and reverse, 5′-CTCGGTCACCTTGCTATCTTG-3′; aromatase forward, 5′-ATGTTCTTGGAAATGCTGAACCC-3′ and reverse, 5′-AGGACCTGGTATTGAAGACGAG-3′; peroxisome proliferator-activated receptor γ (PPARγ) forward, 5′-TTTTCCGAAGAACCATCCGATT-3′ and reverse, 5′-ATGGCATTGTGAGACATCCCC-3′; and 34B4 forward, 5′-AAGCGCGTCCTGGCATTGTCT-3′ and reverse, 5′-CCGCAGGGGCAGCAGTGGT-3′.
4
Quantifying Pnp-Vg Transcript Levels During Sex Transformation in P. platyceros
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We hypothesized that Pnp-Vg transcript levels will increase during transformation from maleness to femaleness and will reach a peak in the NOV stage, just before eggs extrusion. In order to test it, total RNA was extracted and cDNA was synthetized, as described above, from the hepatopancreas of P. platyceros animals at different stages: J (n = 6), M (n = 4), T1 (n = 8), T2 (n = 7), OV F (n = 8) and NOV F (n = 6). Additionally, RNA was extracted from the androgenic gland (AG) of a mature male as a control to normalize the qPCR assay. Relative quantification of transcript levels was performed using Roche Diagnostics FastStart Universal Probe Master Mix (Basel, Switzerland) and Roche Universal Probe Library probes. The following primers and probe were used: qPnp-Vg F (5′-TGTGCAACTAAGGGAGTTATGGA-3′) and qPnp-Vg R (5′-GGTGAGTGCCAAAGAAGAGTG-3′), and Probe #89. P. platyceros 18 S, which served for normalization, was also quantified by means of qPCR using the primers, qPnp-18S F (5′-CCCTAAACGATGCTGACTAGC-3′) and qPnp-18S R (5′-TACCCCCGGAACTCAAAGA-3′), and Probe #152. Reactions were performed in the ABI Prism7300 Sequence Detection System, Applied Biosystems (Foster City, CA).
5
Osteogenic Gene Expression in GMSCs and BMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After osteogenic induction, GMSCs and BMSCs were detected for the expression of four genes related to osteogenesis (ALP, runt‑related transcription factor 2 (RUNX2), osterix and osteocalcin) by RT‐qPCR using primer pairs designed using Primer 3 software showed in supporting infomation Table 2 . The cells were pooled and homogenized in TRIzol reagent at days 3, 7 and 14 to extract total RNA. The SuperScript First‐Strand Synthesis System for RT‐PCR (Invitrogen) was used to synthesize cDNA. After evaluation, cDNA was amplified by SYBR Green‐based RT‐qPCR in a PCR instrument (ABI Prism 7300 Sequence Detection System, Applied Biosystems). The endogenous control (GAPDH) was used to perform data normalization, and comparisons among samples were made by the comparative CT method.
6
Quantitative Real-Time RT-PCR Analysis of Phalaenopsis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time RT-PCR and data analysis involved the ABI PRISM 7300 Sequence Detection System (Applied Biosystems) with SYBR Green PCR Master Mix (Applied Biosystems). Total RNA was isolated from Phalaenopsis sepal, petal and lip tissue. To remove contaminating DNA, RNA samples were treated with DNase I and used for first-strand cDNA synthesis by priming with oligo (dT)25 and catalyzed with Superscript II Reverse Transcriptase (Invitrogen) at 42°C for 1.5 h. The primers for the transcripts investigated were designed on the basis of open reading frame sequences for each gene with use of Primer Express (Applied Biosystems). The thermal cycling condition was 10 min at 95°C, and 40 cycles of 15 sec at 95°C and 1 min at 60°C. Before running real-time PCR, primer efficiency was evaluated by use of both gene-specific and internal-control Actin primers [49 (link),60 (link)] (S1 Table ) at 50-, 150- and 300-nM combinations as described [49 (link)]. We chose the 150-nM concentration for both the target and Actin genes as the most suitable combination. Each sample was amplified in triplicate. With the housekeeping gene Actin, the relative expression level of target genes was presented as 2-ΔCT by the ΔCT method (Applied Biosystems).
7
Quantification of miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissues and cell lines using the miRNeasy Mini Kit (Qiagen). The miRNA Q-PCR Detection Kit (GeneCopoeia) was used for quantification of miRNA levels according to the manufacturer’s protocol. The protocol was conducted for 35 cycles at 95 °C for 3 min, 95 °C for 12 s, and 58 °C for 30 s. The PCR amplification for the quantification of the miR-186 and U6 was performed using TaqMan miRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and TaqMan Human MiRNA Assay Kit (Applied Biosystems, Foster City, CA, USA). The relative expression of miR-186 was shown as fold difference relative to U6. The PCR amplification for the quantification of the NSBP1 and GAPDH mRNAs was performed using an ABI PRISM 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) and a SYBR®Premix Ex Taq™ ii (Perfect Real Time) Kit (Takara Bio, Shiga, Japan). The primers were as follows: miR-186: 5′- GCGGCGCAAAGAATTCTCCT-3′; miR-186 mimics, forward primer: 5′-GCGGCGCAAAGAATTCTCCT-3′ and reverse primer: 5′-GTGCAGGGTCCGAGGT-3′; NSBP1, forward primer: 5′-TCGGCTTTTTTTCTGCTGACTAA-3 and reverse primer: 5′-CTCTTTGGCTCCTGCCTCAT-3′. β-actin, forward primer: 5′- CATTAAGGAGAAGCTGTGCT-3′ and reverse primer: 5′- GTTGAAGGTAGTTTCGTGGA -3′.
8
RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with TRIzol reagent (Invitrogen) and treated with RNase-free DNase I (Takara) to avoid genomic DNA contamination. PCR amplification of the cDNA template was done using Thunderbird SYBR qPCR mix (TOYOBO) on ABI PRISM 7300 sequence detection system (Applied Biosystems).
9
Quantitative Real-Time PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from fresh tumor tissue using TRIzol reagent (Invitrogen). The following gene sequences were designed and synthesized: glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (103 bp) sense primer: 5′-ACAACTTTGGTATCGTGGAAGG-3′, antisense primer: 5′-GCCATCACGCCACAGTTTC-3′; P-gp (99 bp) sense primer: 5′-GGTCAGTGTTG ATGGACAGG-3′, antisense primer: 5′-GTGGTGGCAAACA ATACAGG-3′; NF-κB (87 bp) sense primer: 5′-TCAAGAT CTGCCGAGTGAAC-3′, antisense primer: 5′-CCTCTTTCTGCACCTTGTCA-3′; MRP1 (94 bp) sense primer: 5′-GACCATGAATGTGCAGAAGG-3′, antisense primer: 5′-GGATCTTCGTCTTCCTCAGC-3′; TfR (90 bp) sense primer: 5′-GAAACGCTGTTCAGAAACCA-3′, antisense primer: 5′-GTCAATGTCCCAAACGTCAC-3′. Quantitative real-time polymerase chain reaction (PCR) was performed by monitoring the increase of fluorescence of SYBR Green (Toyobo, Osaka, Japan), with the ABI prism 7300 sequence detection system (Applied Biosystems, Grand Island, NY, USA). The relative mRNA expression levels were calculated by the comparative Ct (ΔΔCt) method, normalized with the average expression of GAPDH.22 (link)
10
Quantitative Analysis of Microglia Cytokines
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!