Luciferase assay system kit

The assessment of luciferase activity was carried out using a luciferase assay system kit (Promega Corp., Madison, WI, USA), in alignment with previously described methods [29 (link)]. Cells were transiently co-transfected with pRL-TK together and either the associated promoter-driven luciferase reporter or mRNA 3’-UTR luciferase reporter. 24 h’ post-transfection, cell extracts were prepared and subjected to the luciferase assay using the designated kit. The luciferase activity was normalized against the internal TK signal, and the outcomes are presented as the mean ± SE from triplicates experiments.

For the reporter assays, A549 cells were stably transfected with a GRE-Luc plasmid, as previously described in Dendoncker et al. (2017) (link) (Dendoncker et al., 2017 (link)), using Lipofectamine and Lipofectamine Plus reagent according to the manufacturer’s instructions. Briefly, the luciferase reporter construct was driven by a synthetic GR-responsive promoter region containing two classic consensus GRE sequences (underlined) derived from the tyrosine aminotransferase (TAT) gene promotor AGATCTCTCTGCTGTACAGGATGTTCTAGCGGATCCTGCTGTACAGGATGTTCTAGCTACCTGCAG succeeded by a minimal IL6 promoter TATA box and followed by the luciferase gene of which the quantified luciferase expression is a direct measure of GR transcriptional activity. A549 cells stably transfected with GRE-Luc were transfected with a plasmid encoding flag-ZBTB32 at concentrations of 100 ng and 400 ng as indicated. Twenty-four hours after transfection, the medium was replaced by Optimem for cell starvation and 48h after transfection, the cells were stimulated with 1 μM Dex for 6h. Luciferase activity was measured using the Luciferase Assay System kit (Promega) on an Envision plate reader (PerkinElmer). The luciferase values are normalized to β-galactosidase activity. Graphs show the mean ± SEM of experiments performed in triplicate.

A segment of the OGT 3′-untranslated region (UTR) that includes both miR-200a and miR-200b binding sites was constructed into the pmirGLO vector (Promega, Madison, WI, USA). The sequence is listed in Supplemental Data 2. HAECs were cotransfected with 1 μg of constructed plasmids and 100 nM of miR-200a mimic, miR-200b mimic, or NC using Lipofectamine™ 2000 (Invitrogen). After 24 h of transfection, the cells were harvested to determine luciferase activity using the Luciferase Assay System Kit (Promega, E1500), as previously described (Lo et al., 2017 (link)).

The luciferase activity assays were carried out in three biological replicates (n = 3). The luciferase protein activity was assayed using the luciferase assay system kit (catalog no. E1500; Promega, USA) with modifications. Briefly, the yeast strains were grown for 8 h at 30°C in SC medium and harvested by centrifugation for 5 min at 4,000 × g. The cell pellet was disrupted using 200 µl of 2× lysis buffer reagent (Promega, USA) and 200 µl of glass beads in a TissueLyser II equipment (Qiagen, USA) for 3 min. Cells were centrifuged for 5 min at maximum speed, and the supernatant containing the protein extract was recovered and quantified by the Bradford standard method. The luciferase activity was assayed combining 5 µl of the total extracted proteins plus 100 µl of luciferase assay reagent (Promega, USA). The luminescence was immediately recorded in a Cytation 3 microplate reader (BioTek, USA), and it was normalized using the total protein concentration of each sample.

A partial IRAK-1 mRNA 3′-UTR containing the miR-146a-5p target site was constructed into a pGL-3-promoter vector (Promega, Madison, WI). HAECs were cotransfected with 1 μg of constructed plasmids and 100 nM of miR-146a-5p mimic and the negative control using Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA). Empty vector was used as blank control. After 24 h of transfection, cells were harvested to measure luciferase activity using the Luciferase Assay System Kit (Promega, E1500), according to the manufacturer's instructions.