Sybr master mix

Total RNA of Arabidopsis and Eucalyptus was extracted using the Plant Total RNA Extraction Kit (Omega, Shanghai, China). The quantity and quality of RNA was verified by using gel electrophoresis and a Nanodrop 2000c ultraviolet spectrophotometer (Eppendorf, Framingham, MA, USA). The purified RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, Nanjing, China). The quality of the cDNA was verified by amplification of the reference genes ACT2 and PP2A from Arabidopsis and Eucalyptus using PCR. The relative gene expression level was quantified by qPCR using SYBR Master Mix (Vazyme, Nanjing, China) according to the manufacturer’s protocol on a LightCycler 96 system (Roche, Basel, Switzerland). PCR conditions were set as follows: 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. After amplification, a melting curve was obtained to confirm the presence of a simple amplicon. The relative gene expression level to the reference genes Arabidopsis ACT2 or Eucalyptus PP2A-1 and PP2A-3 [75 (link)] was calculated based on the 2^−ΔΔCt method. The qPCR experiments were conducted in triplicate. Information on the primers is listed in Table S1.

To compare gene expression of cells which were transfected by lentiviruses, total RNA was extracted from the cells by FastPure® Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, Nanjing, China) and reverse-transcribed to cDNA (RR036A, Takara Bio, Shiga, Japan). The mRNA expression was evaluated using SYBR Mastermix (Q712-02, Vazyme, Nanjing, China) on QuantStudio7 qRT-PCR System (Applied Biosystems) and normalized against the endogenous GAPDH RNA control. The primers were listed as follows: FGFR1 (forward: 5’-ACGCAGGATGGTCCCTT-3’, reverse: 5’-GTTGTGGCTGGGGTTGTAG-3’) and GAPDH (forward: 5’GGACCTGACCTGCCGTCTAG-3’, reverse: 5’-GTAGCCCAGGATGCCCTTGA-3’).

Two-week-old Arabidopsis thaliana leaves were sprayed with 50 mg L⁻¹ guvermectin (GV) once, and the whole plant was ground with liquid nitrogen at 0, 1, 3, 5, and 7 d after GV treatment, then total RNA was extracted using TRIzol reagent [74 (link)]. Meanwhile, the plants sprayed with 0 mg L⁻¹ GV were used as a control at each point. For qRT-PCR, 1 μg total RNA per sample was treated with the PrimeScript™ RT reagent Kit with gDNA Eraser (RR047A, Takara, San Jose, CA, USA). qRT-PCR was performed with SYBR Master Mix (Q711-03, Vazyme, Nanjing, China) on the Bio-Rad iQ5 optical system software (Bio-Rad, Hercules, CA, USA). UBQ5 was used as the internal control gene for expression level normalization. The transcript level of each gene was calculated using the double ΔCt method [34 (link)]. Data analysis was conducted in GraphPad Prism 8. The primers were summarized in Table S3.

Real-time PCR detection (Thermo Fischer, United States) system was used to detect P. aeruginosa in water or LB swab sample. The qPCR reaction mixtures contained 10 µL of SYBR Master Mix (Vazyme, China), 0.8 µL of each primer (5 µM), 2 µL of DNA template, and 6.4 µL of nuclease-free water. Program settings: 95 °C for 60 s, 40 cycles of 95 °C for 10 s and 60 °C for 30 s.

The total RNAs were extracted using OMEGA Total RNA Kit I (Omega, China). Reverse transcription was performed on 1 µg total RNA using GoldenstarRT6cDNA Synthesis Mix (TsingKe Biotech. China). The qRT‐PCR was performed with SYBR Master Mix (Vazyme, China). The primers used for RT‐qPCR were listed in Table S3 (Supporting Information). Relative expression values were obtained by the 2^–ΔΔCt method as elucidated previously.^[61]

qRT‐PCR was performed as described previously [18 (link)]. Briefly, the total RNA was extracted from adjacent normal tissue and prostate cancer by TRIzol reagent and reverse transcribed to cDNA using PrimeScript RT Master Mix (TaKaRa Biotech, Nojihigashi，Japan). Meanwhile, SYBR Master Mix (Vazyme, Nanjing, China) was used for qRT–PCR on the QuantStudio^‐™ 6 Flex System (PE Applied Biosystems, Foster City, CA). The relative expression of mRNA was normalized to ACTB by the 2−ΔCtΔCt method. The forward primer sequence of sANK1 was F 5′GGAGACCATCTCCACCAGG 3′, and the reverse primer sequence was R 5′ CCACCTTGCGAATGATCTTCT 3′. The forward primer sequence of ACTB was F 5′ CATGTACGTTGCTATCCAGGC3′, and the reverse primer sequence was R 5′ CTCCTTAATGTCACGCACGAT 3′.