GMR sensor chips were purchased from MagArray. Each GMR chip has 80 individually addressable sensors arranged in 8 × 10 matrix with a nominal resistance (R0) of 1729 Ω and a magnetoresistance ratio of 11.5%. The sensors do have hysteresis and anisotropy; however, this does not affect the proposed MRX measurement technique since the field is always swept along the same path and the resistance differential is measured. The magnetic particles used in all experiments were coated with streptavidin and purchased from Ocean NanoTech (catalog #: SHS-30-01), Micromod Partikeltechnologie GmbH (Nanomag®-D 130 nm, catalog #: 09-19-132), and Thermofisher Scientific (Dynabeads® MyOne™ Streptavidin T1, catalog #: 65601).
Dynabeads myone streptavidin t1
Manufactured by Thermo Fisher Scientific
Sourced in United States, Norway
Dynabeads MyOne Streptavidin T1 are uniform, superparamagnetic beads coated with streptavidin. They are designed for efficient, rapid, and gentle separation and purification of biotinylated molecules.
Automatically generated - may contain errors
Lab products found in correlation
Qubit dsdna hs assay kit, by Thermo Fisher Scientific (5 mentions)
Clone 2d1, by Bio-Rad (5 mentions)
Bioruptor, by Diagenode (4 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (4 mentions)
Qubit 3.0 fluorometer, by Thermo Fisher Scientific (4 mentions)
Click it nascent rna capture kit, by Thermo Fisher Scientific (4 mentions)
Nextseq 500, by Illumina (3 mentions)
Ampure xp bead, by Beckman Coulter (3 mentions)
Bovine serum albumin (bsa), by Merck Group (3 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Sephadex g 50 quick spin columns, by Merck Group (3 mentions)
Cd66b clone 80h3, by Bio-Rad (3 mentions)
Cd45 clone 2d1, by R&D Systems (3 mentions)
Sureselectxt mouse all exon kit, by Agilent Technologies (3 mentions)
Truseq sbs kit v3, by Illumina (3 mentions)
Hiseq 2500, by Illumina (3 mentions)
Nebnext ultra directional rna library prep kit, by New England Biolabs (3 mentions)
Complete protease inhibitor, by Roche (2 mentions)
Protease inhibitor cocktail, by Roche (2 mentions)
Hiseq 4000, by Illumina (2 mentions)
193 protocols using dynabeads myone streptavidin t1
1
GMR Sensor Chip Characterization and Particle Analysis
2
Biotinylated DARPin Pulldown Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Target proteins were in-vitro translated. An excess of biotinylated DARPins were pre-incubated with pre-equilibrated magnetic Dynabeads MyOne Streptavidin T1 (Thermo Fisher Scientific) in Pulldown (PD) wash buffer (50 mM Tris, pH 8, 150 mM NaCl, 0.1 % (v/v) Tween-20) while rotating for 2 h at 4 °C. The magnetic beads were washed three times with PD wash buffer to remove unbound DARPins and were resuspended in PD wash buffer with the same volume as before to maintain magnetic bead concentrations. 10 µl DARPin loaded beads were mixed with 10 µl in-vitro translated protein, 1× complete protease inhibitor (Roche) and adjusted to a total volume of 1000 µl with PD wash buffer. The PD mix was incubated while rotating overnight at 4 °C. Pulldown samples were washed five times with 1000 µl PD wash buffer and eluted with LDS buffer by boiling at 70 °C for 10 min. Samples were analyzed by western blot as described before.
3
In Situ Hi-C Protocol for Chromatin Conformation Capture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In situ Hi-C was performed as previously described9 (link) with slight modifications. Cells at 80% confluence in 10 cm dish were fixed in 1% pFA at room temperature for 10 min and subjected to the in situ Hi-C procedure. After proximal ligation, ligation products were enriched by centrifugation at 10,000 rpm at 4 °C for 10 min. The pellet was suspended with proteinase K solution consisting of 10 mM Tris-HCl, pH 8.0, 50 mM EDTA, and 2 mg/ml proteinase K (Thermo Fisher Scientific) and incubated at 37 °C for 1 h, followed by overnight incubation at 68 °C with 0.5 M NaCl. DNA was purified by phenol/chloroform extraction and sonicated at 4 °C using Bioruptor (Diagenode) for 15 min by repeating the cycle of 30-sec ON and 1-min OFF. Biotin-labeled DNA was purified using Dynabeads (MyOne Streptavidin T1, Thermo Fisher Scientific). Sequencing adapters were ligated using NEBNext Ultra Ligation module (New England Biolabs, Inc) on Dynabeads, and DNA was PCR-amplified for 8–14 cycles using NEBNext Q5 Hot Start HiFi PCR master Mix and NEBNext multiplex oligos (New England Biolabs, Inc). PCR products were sequenced on Illumina NextSeq 500 platform to obtain 76-bp paired-end reads.
4
Targeted NGS of Cancer Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Targeted NGS was performed using a 105 cancer-related genes panel (all exons, 3′UTR and 5′UTR) including 13 genes involved in the HR pathway and five MMR genes (SureSelectXT Custom Panel, Agilent Technologies, Inc., Santa Clara, CA) (Table S1 ). The libraries were prepared using SureSelectQXT Library Prep Kit (Agilent) according to manufacturer's instructions and sequenced on NextSeq 550 (Illumina, San Diego, CA). For each patient, 2 μL of genomic DNA (25 ng/μL) was used for enzymatic fragmentation. Library amplification was performed using Herculase II Fusion DNA Polymerase (Agilent) and the PCR product was purified using the Agencourt AMPureXP purification bead system (Beckman Coulter; Pasadena, CA). The targeted DNA was captured using streptavidin-coated magnetic beads (Dynabeads MyOne Streptavidin T1; Thermo Fisher Scientific, Waltham, MA) followed by indexing (SureSelectQXT P7 and P5 dual indexing primers). The analysis of amplified indexed library DNA was performed using High Sensitivity D1000 ScreenTape (on Agilent TapeStation). Two samples were excluded (DNA quantity and quality) and 31 were multiplexed into 1.4 pM pool and loaded onto the NextSeq 550 (Illumina).
5
Fibroblasts and Macrophages Co-culture
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
tdTomato+ cells were isolated as above by FACS of freshly isolated cell suspensions from Cx3cr1-CreERT2:Ai14 or Cx3cr1-CreERT2: Ai14: Cx43 fl/fl mice. Primary fibroblasts were freshly isolated from mouse lung cell suspensions from Col1a2-CreERT2: Rosa26-LSL-Salsa6f mice by negative selection of endothelial (CD31), leukocyte (CD45), epithelial (Epcam), vascular endothelial, pericytes & smooth muscle (CD146) and red blood (Ter119) cells by biotin-labeled antibodies and Dynabeads MyOne Streptavidin T1 (Thermo Fisher Scientific, 65601) as per Tsukui et al. (16 (link)). Sorted macrophages and isolated fibroblasts were co-cultured at 1:1 in µ-slide plates (Ibidi, 81506) for 24 hours. Fluorescence images were captured by confocal microscopy with a Leica CTR 6500 microscope, and images were analyzed using Imaris software.
6
Quantitative H3K9me3 Peptide Pulldown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
H3K9me3 or unmethylated H3(1–16) peptides, linked to Dynabeads MyOne streptavidin T1 (Thermo Fisher Scientific), were used in pulldown assays with eluted GST-HP1 in HBS-EP (300 mM NaCl, 10 mM HEPES KOH pH 7.4, 5 mM EDTA and 0.2% NP-40). Pulldown assays were performed in 300 mM NaCl HBS-EP as previously described [4 (link)]. Samples were resuspended in 2 × Laemmli buffer and resolved by SDS-PAGE followed by Coomassie-blue staining. Images were quantified using ImageJ software.
7
Biotin-JM3A Binding Quantification
8
Immunoprecipitation and ELISA for Aβ quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein G magnetic beads (Bio-Rad) were washed in TBS in protein low-binding 96-well plates or 1.5-ml tubes. Brain extract was diluted 4–8-fold in TBS, and 0.15–1 ml diluted extract added to 20 μl washed beads. Antibodies were included at a concentration of 16.7–20 μg/ml. Plates or tubes were agitated overnight at 4°C. Beads were washed three times in TBS. Aβ was eluted and denatured by agitating overnight in TBS containing 5 M GuHCl and 5 mM EDTA. Eluate was assayed by an Aβ monomer-preferring ELISA. Serial dilution of the brain extract before immunoprecipitation resulted in excellent dilution linearity of the ELISA (Supplementary Fig. 1 ). For competition immunoprecipitation (as in Fig. 4A ), brain extracts were diluted 8-fold and pre-incubated with 20 μl Dynabeads MyOne Streptavidin T1 (Thermo) and 100 μg/ml non-biotinylated competitor antibody for 3 h with agitation at 4°C. Biotinylated B24 (Lightning-Link Rapid Type B, Novus Bio) was then added at 2 μg/ml overnight, followed by washing, elution/denaturation in 5 M GuHCl and performing Aβ monomer ELISAs as above.
9
Targeted Capture Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA shearing was performed using Covaris M220 (Covaris Inc., Woburn, MA, USA) and followed by end repair, phosphorylation, and adaptor ligation. Then 200- to 400-bp fragments were selected by bead (Agencourt AMPure XP Kit; Beckman Coulter, Brea, CA, USA) and hybridized with capture probes baits (SureSelectXT Custom 1kb-499kb; Agilent, Santa Clara, CA, USA). Hybrid selection was performed using magnetic beads (Dynabeads™ MyOne™ Streptavidin T1; Thermo Fisher Scientific, Waltham, MA, USA) and followed by PCR amplification. Bioanalyzer (LabChip GX Touch 24 Nucleic Acid Analyzer; Perkin-Elmer, Waltham, MA, USA) was used to evaluate DNA quality and size by high-sensitivity DNA assay. Indexed samples were sequenced on NextSeq 500 (Illumina, Inc., San Diego, CA, USA).
10
Identification of JunB Interactors Using BioID
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The axolotl JunB ORF was subcloned into the EcoRV and BamHI sites of BioID Myc tag vector (Addgene #35700). (5′–3′):
JunB_BioID_Myc_For ATAGATATCTACCATGTGCACCAAGATGGAG
JunB_BioID_Myc_Rev AGGGGATCCTCAAAAGGGCTGCATCTTG
A total of 293 cells were plated in 24-well plate (1 × 105 cells per well) and transfected with either empty BioID + c-Fos, JunB-BioID alone or JunB-BioID + cFos. After 24 h biotin (50 μM) was added to the cell culture media and allowed to incubate for an additional 24 h. Finally, cells were lysed in boiling RIPA buffer and sonicated to lyse cells and sheer DNA. Then 50 μL of pre-washed Dynabeads MyOne Streptavidin T1 (ThermoFischer) was added per lysate and allowed to incubate at 4 °C. The following day the beads were washed 4 times in RIPA buffer and bound proteins were released from beads by addition of 25 μL of LSB, an excess of biotin and incubated at 95 °C for 5 min.
JunB_BioID_Myc_For ATAGATATCTACCATGTGCACCAAGATGGAG
JunB_BioID_Myc_Rev AGGGGATCCTCAAAAGGGCTGCATCTTG
A total of 293 cells were plated in 24-well plate (1 × 105 cells per well) and transfected with either empty BioID + c-Fos, JunB-BioID alone or JunB-BioID + cFos. After 24 h biotin (50 μM) was added to the cell culture media and allowed to incubate for an additional 24 h. Finally, cells were lysed in boiling RIPA buffer and sonicated to lyse cells and sheer DNA. Then 50 μL of pre-washed Dynabeads MyOne Streptavidin T1 (ThermoFischer) was added per lysate and allowed to incubate at 4 °C. The following day the beads were washed 4 times in RIPA buffer and bound proteins were released from beads by addition of 25 μL of LSB, an excess of biotin and incubated at 95 °C for 5 min.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!