3730xl capillary sequencer

DNA extractions were performed using DNeasy Blood and Tissue Kit (Qiagen Inc., Valencia CA, USA) following the manufacturer’s protocol. DNA concentration was determined using a NanoDrop2000 (Thermo Scientific™) and each extract was adjusted to a concentration of approximately 100 ng/µl. We amplified 16 microsatellite loci previously described for pronghorn^{92 (link)–94 (link)} using the M13 genotyping approach^{95 (link)}. Additionally, 12 samples were independently re-genotyped at eight microsatellites in order to estimate our genotyping error rate. Polymerase chain reactions were carried out in an 11.5 µL volume containing 1 µL of the DNA template, 1 × buffer (Invitrogen, Carlsbad, California), 1 mM MgCl₂, 0.2 mM deoxynucleoside triphosphates, 0.05% bovine serum albumin, 0.5 U of Taq DNA Polymerase (Invitrogen), and 0.5 µM of each primer. The polymerase chain reaction profile consisted of an initial denaturalization step at 95 °C for 5 min, followed by 35 cycles of 60 s each at 95 °C, annealing by ramping from 55 to 60 °C, followed by 60 s extension at 72 °C. Cycles were terminated with a final extension stage of 10 min at 72 °C. PCR products were resolved on an Applied Biosystems 3730XL capillary sequencer at the University of Arizona Gene Core Facility and alleles were scored using PeakScanner v1.0 (Applied Biosystems).

The E. coli strains that were isolated from the media containing carbapenem were further analyzed to determine the mechanisms involved in resistance to carbapenems using a multiplex PCR (Dallenne, Costa, Decré, Favier, & Arlet, 2010; Hornsey, Phee, & Wareham, 2011). Briefly, the presence of the most prevalent carbapenemase genes (including bla_KPC, bla_VIM, bla_OXA‐48 group, and bla_IMP) was assessed by multiplex PCR, as previously described (Dallenne et al., 2010) and bla_NDM gene presence was investigated by PCR assay (Hornsey et al., 2011). Metallo‐β‐lactamase production was assessed by the Carbapenemase/Metallo‐β‐Lactamase Confirmation Identification Pack (Rosco Diagnostic Neo‐Sensitabs^™, Eurobio, Courtaboeuf, France).
All amplified PCR products were purified using the ExoSap purification kit (ExoSap‐it, GE Healthcare, Piscataway, NJ, USA), and bidirectional sequencing was performed using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and an Applied Biosystems 3730 XL capillary sequencer. Each sequence was then compared with already known carbapenemase genes available in the NCBI database using the BLAST program. The detection of bla_VIM‐1 gene was confirmed by simplex PCR assay and sequencing using the following primers: VIM_F (5′‐AGTGGTGAGTATCCGACAG‐3′) and VIM_R (5′‐TGCAACTTCATGTTATGCCG‐3′).

The variants detected in HRM analysis were further confirmed via checking with Sanger sequencing for identifying the mutations in EPAS1 sequence. Briefly, after HRM analysis, PCR products from mutant samples were purified using NucleoSpin® Gel and PCR Clean-up kit (Macherey- Nagel, Bethlehem, PA, USA) according to the manufacturer's protocols. Then, the purified PCR products were sequenced using Big Dye Terminator Chemistry version 3.1 (Applied Biosystems, Foster City, CA, USA) under standardized cycling PCR conditions. The generated data were analyzed at the Australian Genome Research Facility using a 3730xl Capillary sequencer (Applied Biosystems). The sequences were analyzed with Sequence Scanner 2 software (Applied Biosystems).