HEK293 cells (CL-0001, Procell Life, China) were incubated in minimum essential medium (MEM; PM150467, Procell, China) containing 1% P/S and 10% FBS. A reporter vector (E1330, Promega Corporation, Madison, WI, USA) with human NMT1 3′-untranslational region (UTR) sequences was constructed to obtain wild-type NMT1 (NMT1-WT; AAAACAGAGGAAATAACACG), whereas the other reporter vector with mutative NMT1 (NMT1-MUT; CCCCCCACAACCCTCCCCCG) 3′-UTR sequences in the SPI1 promoter region was considered as the NC. NMT1-WT or NMT1-MUT and SPI1 overexpression plasmid were transfected into HEK293 cells for 24 h. The luciferase activity was accessed by a dual-luciferase reporter assay system (E1910, Promega, USA) [20 (link)].
Pm150467
Manufactured by Procell
Sourced in China
The PM150467 is a laboratory equipment item. It is designed for general laboratory use, but its core function is not specified further.
Automatically generated - may contain errors
Lab products found in correlation
E1330, by Promega (2 mentions)
E1910, by Promega (2 mentions)
Cl 0001, by Procell (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (2 mentions)
Hek293 cells, by Procell (1 mentions)
Psicheck 2 vector, by Promega (1 mentions)
Pb180120, by Procell (1 mentions)
4 protocols using pm150467
1
NMT1 3'UTR Regulation in HEK293 Cells
2
Cell Culture Protocols for LLC and HEK-293
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LLC cells with H‐2b background (iCell‐m027) were purchased from iCell Bioscience and cultured in Dulbecco's modified eagle medium (DMEM; 10566016, Thermo Fisher) containing 10% fetal bovine serum (FBS; 10100147, Thermo Fisher) and 1% penicillin‐streptomycin solution (G4003, Servicebio). HEK‐293 cells (CL‐0001, Procell) were maintained in minimum essential medium (PM150467, Procell) supplemented with 10% FBS and 1% penicillin‐streptomycin solution. Cell culture was carried out in a 5% CO2 incubator at 37°C.
3
Luciferase Reporter Assay for miRNA Targeting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild-type (WT) luciferase reporter plasmid (CDKN2B-AS1-WT or P4HA1-WT) and mutant (MUT) reporter plasmid (CDKN2B-AS1-MUT or P4HA1-MUT) were constructed using psiCHECK-2 vector (C8021, Promega, USA). The sequences of miR-122-5p mimic (M) (miR10000421-1-5) and mimic control (MC) (miR1N0000001-1-5) were purchased from RIBOBIO (China). Subsequently, the luciferase reporter recombinant plasmid and miR-122-5p mimic or mimic control were co-transfected into HEK293 cells (CL-0001, Procell, China) (which were used as tool cells), and then cultured in minimum essential medium (PM150467, Procell, China) at 37 °C. After transfection, the luciferase activity in cell lysates was measured using the dual-luciferase reporter system (D0010, Solarbio, China), and normalized to Renilla luciferase activity.
4
Characterizing KLF5-AQP3 Regulatory Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK-293 cells (CL-0001, Procell, China) were cultivated in Minimum Essential Medium (MEM; PM150467, Procell, China) enriched with 10% FBS and 1% Penicillin-Streptomycin (PB180120, Procell, China). The binding sites of KLF5 and AQP3 were predicted by JASPAR (https://jaspar.genereg.net/). Based on that, the wild-type (WT) reporter vector of AQP3 was constructed in the reporter vector (E1330, Promega, USA), whereas the other reporter vector carrying AQP3 mutation (MUT1/2/3) was the negative control. Next, the wild-type and mutated vectors of AQP3 (including AQP3-WT and AQP3-MUT1/2/3) and KLF5 overexpression plasmid were separately transfected into HEK-293 cells. 48 h later, the luciferase activity was conducted using a commercial kit (E1910, Promega, USA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!