Log In Sign up
The largest database of trusted experimental protocols

Platinum sybr green qpcr kit

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The Platinum SYBR Green qPCR Kit is a reagent kit designed for quantitative real-time PCR (qPCR) analysis. The kit contains a proprietary Platinum Taq DNA polymerase, SYBR Green I dye, and other necessary components for performing qPCR experiments.

Automatically generated - may contain errors

Lab products found in correlation

Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (16 mentions) Dna engine with chromo 4 detector, by Bio-Rad (15 mentions) Rneasy mini kit, by Qiagen (5 mentions) Superscript first strand synthesis system, by Thermo Fisher Scientific (2 mentions) Chromo 4 detector, by Bio-Rad (2 mentions) Trizol reagent, by Thermo Fisher Scientific (2 mentions) Superscript 3 system, by Thermo Fisher Scientific (2 mentions) Quantstudio 3, by Thermo Fisher Scientific (1 mentions) Dna engine, by Bio-Rad (1 mentions) M mlv kit, by Thermo Fisher Scientific (1 mentions) Abi stepone real time pcr system, by Thermo Fisher Scientific (1 mentions) Tnf α, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

SYBR Green (3216 citations) SYBR Green kit (254 citations) SYBR Green qPCR kit (96 citations) Platinum SYBR Green (47 citations) Platinum SYBR Green Kit (13 citations) SuperScript III Platinum SYBR Green One-Step qPCR kit (11 citations) Platinum SYBR Green qPCR (3 citations) QPCR SYBR-Green (2 citations) SYBR qPCR kit (2 citations) QPCR kits (2 citations)

26 protocols using platinum sybr green qpcr kit

1

Quantitative PCR Analysis of Liver mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from 50 mg of liver tissue with TRIzol reagent, following the manufacturer's protocol. The RNA was reverse transcribed into cDNA using the SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA, USA). Quantitative-PCR was performed using the DNA Engine with Chromo 4 Detector (MJ Research, Waltham, MA, USA). The reactions were set up in 20 μl total volumes with 1× SuperMix (Platinum SYBR Green qPCR Kit; Invitrogen), cDNA (2 μl) and 0.5 μM of each primer. The PCR cycle was as follows: 50°C for 2 min and 95°C for 5 min, followed by 50 cycles of 95°C for 15 s and 60°C for 30 s. The relative mRNA levels were normalized to the level of hypoxanthine-guanine phosphoribosyltransferase (HPRT) and calculated by using the 2−ΔΔCt method. All samples were run in duplicate to ensure amplification integrity.
Zhang L., Ren F., Zhang X., Wang X., Shi H., Zhou L., Zheng S., Chen Y., Chen D., Li L., Zhao C, & Duan Z. (2016). Peroxisome proliferator-activated receptor alpha acts as a mediator of endoplasmic reticulum stress-induced hepatocyte apoptosis in acute liver failure. Disease Models & Mechanisms, 9(7), 799-809.
+ Open protocol
+ Expand
2

Quantitative RT-PCR Analysis of Mouse Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA (2μg) was reverse-transcribed into cDNA using SuperScriptTM III First-Strand Synthesis System (Invitrogen, Carlsbad, CA). Quantitative-PCR was performed using the DNA Engine with Chromo 4 Detector (MJ Research, Waltham, MA). In a final reaction volume of 20 μl, the following were added: 1xSuperMix (Platinum SYBR Green qPCR Kit, Invitrogen, Carlsbad, CA), cDNA and 0.5 mM of each primer. Amplification conditions were: 50°C (2 min), 95°C (5 min) followed by 50 cycles of 95 °C (15 s), 60 °C (30 s). Primers used to amplify a specific mouse gene fragments are the same as described previously (53 (link)).
Zhu J., Lu T., Yue S., Shen X., Gao F., Busuttil R.W., Kupiec-Weglinski J.W., Xia Q, & Zhai Y. (2015). Rapamycin protects livers from ischemia and reperfusion Injury via both autophagy induction and mTORC2-Akt activation. Transplantation, 99(1), 48-55.
+ Open protocol
+ Expand
3

Quantitative RT-PCR Protocol for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA (1 μg), purified using an RNeasy Mini Kit (QIAGEN) was used to synthesize cDNA using SuperScript First-Strand Synthesis System (Invitrogen). Approximately 1/60 of the cDNA was amplified using a Platinum SYBR Green QPCR kit (Invitrogen) under the following conditions: 50°C for 2 min, then 95°C for 2 min followed by 40 cycles of 95°C for 15 s, then 60°C for 30 s, with a final cycle consisting of 95°C for 1 min, 60°C for 30 s, and 95°C for 15 s. Primer sequences are in Table S4.
Meek S., Wei J., Oh T., Watson T., Olavarrieta J., Sutherland L., Carlson D.F., Salzano A., Chandra T., Joshi A, & Burdon T. (2020). A Stem Cell Reporter for Investigating Pluripotency and Self-Renewal in the Rat. Stem Cell Reports, 14(1), 154-166.
+ Open protocol
+ Expand
4

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA (2.5 μg) was reverse-transcribed into cDNA using SuperScriptTM III System (Invitrogen, Carlsbad, CA). Quantitative-PCR was performed using SuperMix (Platinum SYBR Green qPCR Kit, Invitrogen, Carlsbad, CA) in the DNA Engine with Chromo 4 Detector (MJ Research, Waltham, MA) as described previously (20 (link)). We used the comparative CT method (21 (link)) to quantitate gene expression levels, and target gene expressions were normalized using the HPRT gene expression level of the same samples.
Rao J., Yue S., Fu Y., Zhu J., Wang X., Busuttil R.W., Kupiec-Weglinski J.W., Lu L, & Zhai Y. (2014). ATF6 Mediates a Pro-inflammatory Synergy between ER Stress and TLR Activation in the Pathogenesis of Liver Ischemia Reperfusion Injury. American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons, 14(7), 1552-1561.
+ Open protocol
+ Expand
5

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Quantitative real-time PCR was performed using the DNA Engine with Chromo 4 Detector (MJ Research, Waltham, MA). In a final reaction volume of 25 μl, the following were added: 1× SuperMix (Platinum SYBR Green qPCR Kit; Invitrogen, San Diego, CA) cDNA and 10 μM of each primer. Amplification conditions were: 50 °C (2 min), 95 °C (5 min), followed by 40 cycles of 95 °C (15 s) and 60 °C (30 s). Primer sequences used for the amplification were shown in Supplementary Table 1.
Zhu Q., Wang H., Jiang B., Ni X., Jiang L., Li C., Wang X., Zhang F., Ke B, & Lu L. (2018). Loss of ATF3 exacerbates liver damage through the activation of mTOR/p70S6K/ HIF-1α signaling pathway in liver inflammatory injury. Cell Death & Disease, 9(9), 910.
+ Open protocol
+ Expand
6

Quantitative Real-Time PCR Analysis of Inflammatory Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RT-PCR was performed as described [18 (link)]. Total RNA was purified from liver tissue or cell cultures using RNeasy Mini Kit (Qiagen, Chatsworth, CA) according to the manufacturer’s instructions. Quantitative real-time PCR was carried out using the QuantStudio 3 (Applied Biosystems by ThermoFisher Scientific). The following were added in the final reaction volume of 25 μl: 1 × SuperMix (Platinum SYBR Green qPCR Kit; Invitrogen) cDNA and 10 μM of each primer. Amplification conditions were: 50 °C (2 min), 95 °C (5 min), followed by 40 cycles of 95 °C (15 s) and 60 °C (30 s). Primer sequences used to amplify TNF-α, IL-1β, CCL-2, and CXCL-10 were shown in Additional file 2: Table S1.
Xu D., Qu X., Tian Y., Jie Z., Xi Z., Xue F., Ma X., Zhu J, & Xia Q. (2022). Macrophage Notch1 inhibits TAK1 function and RIPK3-mediated hepatocyte necroptosis through activation of β-catenin signaling in liver ischemia and reperfusion injury. Cell Communication and Signaling : CCS, 20, 144.
+ Open protocol
+ Expand
7

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA (2.5 μg) was reverse-transcribed into cDNA using the SuperScript™ III System (Invitrogen, CA). Quantitative real-time PCR was performed using a Platinum SYBR Green qPCR Kit (Invitrogen). The amplification conditions were 50°C (2min), 95°C (5min), followed by 40 cycles of 95°C (15sec) and 60°C (30sec). Primer sequences used for the amplification were shown in Supplementary Table 1.
Jiang L., Ke M., Yue S., Xiao W., Yan Y., Deng X., Ying Q.L., Li J, & Ke B. (2017). Blockade of Notch Signaling Promotes Acetaminophen-Induced Liver Injury. Immunologic research, 65(3), 739-749.
+ Open protocol
+ Expand
8

Quantitative PCR Analysis of Immune and Endothelial Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA (2.0μg) was reverse-transcribed into cDNA using SuperScriptTM III First-Strand Synthesis System (Invitrogen, Carlsbad, CA). Quantitative-PCR was performed using the DNA Engine with Chromo 4 Detector (MJ Research, Waltham, MA). In a final reaction volume of 20 μl, the following were added: 1xSuperMix (Platinum SYBR Green qPCR Kit, Invitrogen, Carlsbad, CA), cDNA and 0.5 mM of each primer. Amplification conditions were: 50°C (2 min), 95°C (5 min) followed by 50 cycles of 95 °C (15 s), 60 °C (30 s). The primers for mouse gene fragments, including TNF-a, IL-1b, IL-6, IL-10, IL-12p40 were as described previously (18 (link)). Additional primers to study LSECs are the followings: von Willebrand factor (vWF) F: GGGTTTTCTCTCCCTGGCTC; R: ACAGAGCCACAAAGGA CTCG; CD31 F:CAAGGCCAAACAGAAACCCG; R:TCGACCTTCCGGATCTCACT; vascular cell adhesion molecule 1 (VCAM-1) F:CTGGGAAGCTGGAACGAAGT; R:GCCAAACACTTGACCGTGAC.
Yue S., Zhou H., Wang X., Busuttil R.W., Kupiec-Weglinski J.W, & Zhai Y. (2017). Prolonged Ischemia Triggers Necrotic Depletion of Tissue Resident Macrophages to Facilitate Inflammatory Immune Activation in Liver Ischemia Reperfusion Injury. Journal of immunology (Baltimore, Md. : 1950), 198(9), 3588-3595.
+ Open protocol
+ Expand
9

Quantitative Real-Time PCR Analysis of Liver mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from liver tissues using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. RT of RNA (2.5 µg) into cDNA was performed using a SuperScript III first-strand synthesis system according to the manufacturer's protocol (Invitrogen; Thermo Fisher Scientific, Inc.). A DNA Engine with a Chromo 4 detector (MJ Research, Inc.; Bio-Rad Laboratories, Inc.) was used for qPCR. The final reaction volume was 20 µl and consisted of 1X super mix (Platinum SYBR-Green qPCR kit; Invitrogen; Thermo Fisher Scientific, Inc.), 2 µl cDNA and 0.5 µl each primer. The amplification conditions were as follows: Initial denaturation at 50°C (2 min), 95°C (5 min), followed by 50 cycles of 95°C (15 sec) and 60°C (30 sec). The mRNA expression levels were calculated using the 2−ΔΔCq method (24 (link)). The sequences of the PCR primers used are listed in Table I and were produced by Sangon Biotech, Co., Ltd.
Tian Y., Ren F., Xu L, & Zhang X. (2021). Distinct effects of different doses of kaempferol on D-GalN/LPS-induced ALF depend on the autophagy pathway. Molecular Medicine Reports, 24(3), 682.
+ Open protocol
+ Expand
10

Quantitative RT-PCR of Mouse Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA (2μg) was reverse-transcribed into cDNA using a SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA). Quantitative PCR was performed using DNA Engine with 4 Detector (MJ Research, Waltham, MA). In a final reaction volume of 20 μl, the following were added: 1× SuperMix (Platinum SYBR Green qPCR Kit, Invitrogen), cDNA, and 0.5 mM of each primer. Amplification conditions were 50 °C for 2 min and 95 °C for 5 min, followed by 50 cycles of 95 °C for 15s and then 60 °C for 30s. Primers used to amplify specific mouse gene fragments were the same as described previously (31 (link)).
Ni M., Zhou H., Zhang J., Jin D., Lu T., Busuttil R.W., Kupiec-Weglinski J.W., Wang X, & Zhai Y. (2020). Isoform- and cell-type specific roles of Glycogen Synthase Kinase 3 N-terminal serine phosphorylation in liver ischemia reperfusion injury. Journal of immunology (Baltimore, Md. : 1950), 205(4), 1147-1156.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!