Rneasy reagent

Total RNA was prepared with RNeasy Reagent (Qiagen Hilden, Germany) according to the manufacturer's instructions and reverse-transcribed by random priming and a Superscript first strand synthesis kit (Invitrogen, Carlsbad, CA, USA). Quantitative RT-PCR analysis was carried out using the 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primer sequences are available online as indicated in Table S1.

HOXA3 expression in NSCLC samples was detected by RT-qPCR which was performed as previously described (20 (link)–22 (link)). Total RNA was extracted from the tumour and cancer-adjacent normal tissues using the RNeasy reagent (Qiagen, Shanghai, China). The RNA concentration was measured using NanoDrop2000 (Thermo Fisher Scientific, Wilmington, DE, USA). Total RNA was reverse transcribed (10 µl reaction system) using a reverse transcription kit (ABI, Life Technologies, Carlsbad, CA, USA) to obtain cDNA for RT-qPCR. SYBR-Green (Shanghai GeneCore BioTechnologies Co., Ltd., Shanghai, China) was used to perform RT-qPCR and the distinctiveness of the PCR product was differentiated based on melting curve (23 (link)–26 (link)). RT-qPCR was carried out using the following conditions: preheating for 10 min at temprature 95°C; and then repeating 40 cycles in temperature 95°C for 15 sec and 60 sec at 60°C. The primer sequences of HOXA3 were as follows: Upstream, TCATTTAAGAGCGCCTGGACA and downstream primer, GAGCTGTCGTAGTAGGTCGC. Using GAPDH as an internal reference gene and the primer sequence were as follows: Upstream, 5′-TGGTCCCTGCTCCTCTAAC-3′, downstream primer, 5′-GGCTCAATGGCGTACTCTC-3′. The relative expression level of HOXA3 in this study was calculated using the 2^−ΔΔCq (27 (link)) formula (28 (link), 29 (link)).

Total RNA was purified with RNEasy reagent (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. One microgram of total RNA was used for reverse transcription reaction; complementary DNA was synthesized using a SuperScript first-strand synthesis system (Invitrogen, Carlsbad, CA, USA). Complimentary DNA was amplified by PCR using the AmpliTag Gold Kit (Applied Biosystems, Foster City, CA, USA). The PCR products were resolved on 2% agarose gels. Quantitative PCR was performed with Platinum SYBR Green qPCR Supermix UDG (Invitrogen, USA) and analyzed with the Step One Plus real-time PCR system (Applied Biosystems, USA). Primer sequences are shown in Table 1.

As for qRT-PCR, total RNA was extracted from 24 prostate cancer tissues and adjacent normal tissue using the RNeasy reagent (QIAGEN, Shanghai, China) according to the manufacturer’s instructions. The ND-2000 Nanodrop system (Thermo Scientific, USA) was used to detect the concentration and purity of RNA, and an A260/280 ratio between 1.8 and 2.0 was considered the premise of acceptable quality. Single-stranded cDNA was generated from 1 µg total RNA in a 20-µL reaction volume using oligodT primers according to the protocol supplied with the Primer Script TM RT Reagent (TaKaRa, Japan). The relative expression levels were measured by qPCR using the ABI 7900HT instrument (Applied Biosystems, USA) in a total volume of 10 µL with the SYBR green detection system (Takara, Japan) and GAPDH was used as an endogenous control. The cDNA was amplified by PCR using the following primers: NOTCH1 forward primer: 5'-TGGACCAGATTGGGGAGTTC-3', reverse primer: 5'-GCACACTCGTCTGTGTTGAC-3'; NOTCH2 forward primer: 5'-CCTTCCACTGTGAGTGTCTGA-3', reverse primer: 5'-AGGTAGCATCATTCTGGCAGG-3'; NOTCH3 forward primer: 5'-CGTGGCTTCTTTCTACTGTGC-3', reverse primer: 5'-CGTTCACCGGATTTGTGTCAC-3; NOTCH4 forward primer: 5'-TGTGAACGTGATGTCAACGAG-3', reverse primer: 5'-ACAGTCTGGGCCTATGAAACC-3'. GAPDH (internal control) forward primer: 5'-GGAGCGAGATCCCTCCAAAAT-3', reverse primer: 5'-GGCTGTTGTCATACTTCTCATGG-3'.