Nanodrop spectrophotometer

RNA was extracted 24 hours after transfection with the RNeasy plus minikit (Qiagen) following manufacturer’s instructions. RNA quantity and quality were evaluated with a Nanodrop Spectrophotometer (Labtech). cDNA synthesis was carried out with Superscript Vilo kit (Thermo Fisher Scientific). Gene expression was quantified by quantitative PCR. Each 25 µL reaction contained 12.5 µl SYBR Green PCR Master Mix (Thermo Fisher Scientific), 250 nM of each primer, and 1ul cDNA. All reactions were carried out in triplicate on an AB7500 Real-Time PCR system (Applied Biosystems). Initial activation was at 95 °C for 10 minutes, followed by 40 cycles of 95 °C for 15 seconds and 60 °C for 60 seconds. The 2-ΔΔCt method was used for the relative quantification of gene expression in MG-63_VEGF165 cells compared to MG-63_GFP cells, and data were normalized to β-actin expression. Primer sequences used were VEGF forward CACACAGGATGGCTTGAAGA, VEGF reverse AGGGCAGAATCATCACGAAG, β-actin forward GGCATCCTCACCCTGAAGTA and β-actin reverse AGGTGTGGTGCCAGATTTTC.

RNA was extracted from samples in Trizol Reagent (Invitrogen) according to manufacturer’s instructions. The concentration and purity of RNA was determined by optical densities at 230 nm, 260 nm and 280 nm using a NanoDrop Spectrophotometer (Labtech, Uckfield, UK), and cDNA produced from 500ng RNA using Superscript VILO cDNA synthesis kit (Invitrogen) following manufacturer’s instructions.

A specific miRNA extraction was performed for serum samples (around 100 μL) using the mirVana^TM PARIS^TM kit (ThermoFisher). RNA was first eluted in 50 μl RNase-free water and concentrated after NaOAc precipitation. The RNA pellet was finally resuspended in 10 μl RNase free water. For muscle samples, total RNA extraction was performed from frozen sections corresponding to approximately 1 mm thick of muscle transverse sections from Gastrocnemius Anterior (Ga) by the Trizol method (Invitrogen). RNA was eluted in 20 μl RNase-free water and treated with Free DNA kit (Ambion) to remove residual DNA. Total RNA extracted for each sample was quantified by using a Nanodrop spectrophotometer (ND8000 Labtech, Wilmington Delaware).
Quantification of miRNAs was performed using Exiqon miRCURY LNA™ Universal RT microRNA PCR. Total RNA (20 ng) was converted into poly-A primed universal cDNA and microRNAs were quantified in duplicate for each sample with miRNA-specific LNA primers on the LightCycler480 (Roche) following manufacturer’s guidelines. Quantification cycle (Cq) values were calculated with the LightCycler® 480 SW 1.5.1 using 2nd Derivative Max method. RT-qPCR results, expressed as raw Cq were normalized to the miRNAs identified as the most stable, miR-16 for individual assays in serum, and miR-93 in muscle samples. The relative expression was calculated using the 2^−ΔCt method.

Total RNA in Hep G2 cells and mice liver tissues of different concentration of B12 were isolated using Qiazol (Qiagen, Manchester, UK) according to the manufacturer’s instruction. RNA quantification, quality and integrity (260/230 and 260/280 ratios and concentrations) were carried out using a NanoDrop spectrophotometer (Labtech, Heathfield, UK). Total RNA (300 ng) was reverse transcribed to cDNA using reverse M-MLV transcriptase (ThermoScientific, Loughborough, UK). Gene expression of CD320 in the Hep G2 cell line (CD320: cat no Hs00213164_m1; TCN2: cat no Hs00165902_m1; Applied Biosystems, Thermo Fisher Scientific, Horsham, UK) and mice liver tissues (CD320: forward primer—GGTCCAAGTCTCCGGCTCTA-, reverse primer–AGCACATGACTCAATCCTACAGT; TCN2: forward primer—CTTTGCTGGATCTTCCTTGG, reverse primer—TCCTGGGGTTTGTAGTCAGC; Merck Life Science UK Ltd, Dorset, UK) were determined by quantitative real time polymerase chain reaction (Applied Biosystems 7500 Fast Real-Time PCR Thermal Cycler, Thermo Fisher Scientific, Horsham, UK). The housekeeping genes, 18s rRNA in the HepG2 cell line (cat no 4319413E; Applied Biosystems, Thermo Fisher Scientific, Horsham, UK) and L19 in mice liver tissues (forward primer—GGAAAAAGAAGGTCTGGTTGGA, reverse primer—TGATCTGCTGACGGGAGTTG; Merck Life Science UK Ltd, Dorset, UK) were used to determine relative gene expression.

DNA was extracted using the QIAampDNA mini‐kit® (Qiagen Inc., Courtaboeuf, France) according to the manufacturer's protocols. Tissues were disrupted in lysis buffer. After removing the paraffin, the DNA was purified via sequential centrifugation through membrane spin columns. The purity and quantity of DNA were assessed by measuring the absorbance ratio at 260/280 nm with a NanoDrop® Spectrophotometer (LabTech, Palaiseau, France). A brain tumor gene mutation panel was developed using the MassARRAY iPlex technology and MassARRAY online design tools (Agena Bioscience), and included IDH1 mutations, IDH2 mutations, H3F3A mutations (codon 27–34), HIST1H3B mutations (codon 27) FGFR1 mutations, TERT mutations, and BRAF mutations (V600E). The MassARRAY iPlex procedure involves a three‐step process consisting of the initial polymerase chain reaction (PCR), inactivation of unincorporated nucleotides by shrimp alkaline phosphatase, and a single‐base primer extension. Afterwards, the products are nano‐dispensed onto a matrix‐loaded silicon chip (SpectroChipII, Ageno Bioscience). Finally, the mutations are detected by matrix‐assisted laser desorption‐ionization–time of flight (MALDI–TOF) mass spectrometry. Data analysis was performed using MassARRAY Typer Analyzer software 4.0.4.20 (Ageno Bioscience), which facilitates the visualization of data patterns as well as the raw spectra.

Total RNA was extracted using the RNeasy mini or micro kit following the manufacturer’s instructions (Qiagen, Santa Clara, CA, USA), quantified using a NanoDrop spectrophotometer (Labtech, Wilmington, DE, USA) after DNase treatment (Ambion, Austin, TX, USA) and converted to cDNA by reverse transcription as described previously [64 (link)]. Oligonucleotide primers used for semiquantitative RT-PCR analysis of gene expression were designed using Oligo Primer Analysis Software v.7 (Molecular Biology Insights Inc., Colorado Springs, CO, USA) and are listed in Additional file 4: Table S2. Data were normalized to mRNA levels of the housekeeping gene RPS18 and were calculated using the 2–∆Ct method.