Si rock1

Melanoma cell lines (A375 (ATCC^® CRL-1619), SK-MEL-110 (ATCC^® HTB-67), HS-1 (ATCC^® CRL-9446), MEL-RM (ATCC^® HTB-70), and A2508 (ATCC^® CRL-11147)) and normal human epidermal melanocytes (HEMa-LP(ATCC^® PCS-200-013)) were obtained from American Type Culture Collection and cultivated in Dulbecco’s Modified Eagle Medium (DMEM, Gibco-BRL, Grand Island, NY, USA) and Medium 254 (Cascade Biologics, Portland, OR, USA) containing 10% fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO), penicillin (100 μL/mL), streptomycin (100 mg/mL) and glutamine. All cells were maintained in a 37°C atmosphere that containing 5% CO₂. pcDNA-XIST (Rho-associated coiled-coil containing protein kinase 1, XIST-overexpressing plasmid), si-XIST (siRNA targeting XIST), si-ROCK1 (siRNA targeting ROCK1), si-NC (negative control siRNAs), miR-139-5p mimic (overexpressing oligonucleotides) and mimic NC (negative control) were all obtained from GenePharma (Shanghai, China). Lipofectamine 3000 (Invitrogen) was utilized for transfecting all oligonucleotides and plasmids into melanoma cells.

miRNA-101-3p mimic (5′-UACAG UACUGUGAUAACUGAACAGUUAUCACAGUACUGU AUU-3′), miRNA-101-3p mimic-inhibitor (5′-UUCAGUUAU CACAGUACUGUA-3′), small interfering RNA (si)-SNHG1, si-ROCK1 and the negative control (5′-UUCUCCGAACGU GUCACGUTT-3′) were obtained from GenePharma Co., Ltd. (Shanghai, China). Lipofectamine^® 2000 (Thermo Fisher Scientific, Inc.) was used for miRNA and siRNA transfection. The sequences for si-SNHG1 were sense, 5′-CUUAAAGUG UUAGCAGACATT-3′ and antisense, 5′-AAUGUCUGCUAA CACUUUAAG-3′; the siROCK1 sequences were sense, 5′-GCACCAGTTGTACCCGATTTA-3′ and antisense, 5′-TAA ATCGGGTACAACTGGTGC-3′.

Normal human astrocytes (NHAs) and human glioma cell lines (U251 and LN229) were purchased from the Chinese Academy of life Sciences (Shanghai, China) and cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Carlsbad, CA, USA) with 10% fetal calf serum (Invitrogen) at 37°C with 5% CO₂.
MiR-206 mimic (miR-206), miR-206 inhibitor (miR-206-I), their corresponding control (miR-NC or miR-NC-I), small interfering RNA (siRNA) targeting ROCK1 (si-ROCK1) and siRNA negative control (si-NC) were synthesized by Genepharma (Shanghai, Chinaexit ), and then these oligonucleotides or vectors were transfected into U251 and LN229 cells using Lipofectamine 2000 (Invitrogen) for 48 h before propofol treatment.
propofol was obtained from Sigma (St Louis, MO, USA), following by being dissolved in DMSO in accordance with the protocol of the manufacturer. Cells were maintained in 96-well plates and treated with 5 µg/mL propofol for 6 h, and cells treated by the same volume of PBS were regarded as blank controls.